Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Notamacropus eugenii (tammar wallaby) Neu-Mir-124-P3-v1_5p* (star (passenger)) URS00003AA409_9315

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGUGUUCACAGCGGACCUUGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Alligator mississippiensis (American alligator) ami-miR-124-5p
  2. Anolis carolinensis (green anole) Aca-Mir-124-P3-v1_5p* (star (passenger))
  3. Bos taurus (domestic cattle) Bta-Mir-124-P3-v1_5p* (star (passenger))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-124-P3-v1_5p* (star (passenger))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-124-P3-v1_5p* (star (passenger))
  6. Canis lupus familiaris Cfa-Mir-124-P3-v1_5p* (star (passenger))
  7. Cavia porcellus (domestic guinea pig) cpo-miR-124-5p
  8. Chrysemys picta bellii Cpi-Mir-124-P3-v1_5p* (star (passenger))
  9. Columba livia (rock pigeon) cli-miR-124-2-5p
  10. Danio rerio dre-miR-124-5p
  11. Dasypus novemcinctus dno-miR-124-5p
  12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-124-P2-v1_5p* (star (passenger))
  13. Eptatretus burgeri (inshore hagfish) Ebu-Mir-124-P6-v1_5p* (star (passenger))
  14. Equus caballus (horse) Eca-Mir-124-P3-v1_5p* (star (passenger))
  15. Gadus morhua (Atlantic cod) gmo-miR-124-5p
  16. Gallus gallus Gga-Mir-124-P3-v1_5p* (star (passenger))
  17. Gekko japonicus Gja-Mir-124-P3-v1_5p* (star (passenger))
  18. Homo sapiens (human) hsa-miR-124-5p
  19. Latimeria chalumnae (coelacanth) Lch-Mir-124-P3_5p* (star (passenger))
  20. Lepisosteus oculatus (spotted gar) Loc-Mir-124-P3-v1_5p* (star (passenger))
  21. Loxodonta africana (African savanna elephant) Laf-Mir-124-P3-v1_5p* (star (passenger))
  22. Macaca mulatta (Rhesus monkey) Mml-Mir-124-P3-v1_5p* (star (passenger))
  23. Microcaecilia unicolor Mun-Mir-124-P3-v1_5p* (star (passenger))
  24. Microcebus murinus (gray mouse lemur) Mmr-Mir-124-P3-v1_5p* (star (passenger))
  25. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-124-P3-v1_5p* (star (passenger))
  26. Monopterus albus (swamp eel) Mal-Mir-124-P3a-v1_5p* (star (passenger))
  27. Mus musculus mmu-miR-124-5p
  28. Ophiophagus hannah oha-miR-124-5p
  29. Ornithorhynchus anatinus oan-miR-124a-5p
  30. Oryctolagus cuniculus ocu-miR-124-5p
  31. Paralichthys olivaceus (Japanese flounder) pol-miR-124-5p
  32. Petromyzon marinus pma-miR-124-5p
  33. Pongo abelii (Sumatran orangutan) Pab-Mir-124-P3-v1_5p* (star (passenger))
  34. Python bivittatus (Burmese python) pbv-miR-124b-5p
  35. Rattus norvegicus rno-miR-124-5p
  36. Sarcophilus harrisii Sha-Mir-124-P3-v1_5p* (star (passenger))
  37. Scyliorhinus torazame Sto-Mir-124-P3-v1_5p* (star (passenger))
  38. Sphenodon punctatus (tuatara) Spt-Mir-124-P3f_5p* (star (passenger))
  39. Taeniopygia guttata (zebra finch) Tgu-Mir-124-P3-v1_5p* (star (passenger))
  40. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-124-P2b-v1_5p* (star (passenger))
  41. Xenopus laevis xla-miR-124-5p
  42. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-124-P3-v1_5p* (star (passenger))
Relationships

Molecular Relationships