Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cochliomyia macellaria (secondary screw-worm) mature cma-miR-995 URS00003A588B_66361

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCACAUGAUUCGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bactrocera dorsalis (oriental fruit fly) bdo-miR-995
  2. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-995
  3. Drosophila ananassae Dan-Mir-29-P2g_3p (mature (guide))
  4. Drosophila melanogaster (fruit fly) dme-miR-995-3p
  5. Drosophila mojavensis Dmo-Mir-29-P2g_3p (mature (guide))
  6. Drosophila simulans dsi-miR-995-3p
  7. Drosophila virilis dvi-miR-995-3p
  8. Drosophila yakuba Dya-Mir-29-P2g_3p (mature (guide))
  9. Glossina pallidipes (tsetse fly) Gpa-Mir-29-P2g_3p (mature (guide))
Relationships

Molecular Relationships