Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) Bta-Mir-362-P1_3p (mature (co-guide)) URS00003A19A3_9913

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACACACCUAUUCAAGGAUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Cavia porcellus cpo-miR-362-3p
  2. Dasypus novemcinctus (nine-banded armadillo) dno-miR-362-3p
  3. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-362-P1_3p (mature (co-guide))
  4. Equus caballus eca-miR-362-3p
  5. Gorilla gorilla gorilla ggo-miR-362 (MIR362)
  6. Gorilla gorilla ggo-miR-362
  7. Homo sapiens (human) hsa-miR-362-3p
  8. Macaca mulatta (Rhesus monkey) mml-miR-362-3p
  9. Oryctolagus cuniculus (rabbit) ocu-miR-362-3p
  10. Pan troglodytes (chimpanzee) ptr-miR-362
  11. Pongo pygmaeus ppy-miR-362-3p