Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-21a-5p URS000039ED8D_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 6 databases (RefSeq, TarBase, ENA, PirBase, LncBase, miRBase). Mus musculus (house mouse) mmu-miR-21a-5p sequence is a product of 21, miR-21a, mmu-miR-21a, miR-21a-5p, miR-21, Mir21a, mmu-miR-21a-5p genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610006G08Rik, 0610006H10Rik, 0610007D13Rik, 0610010B06Rik, 0610010C24Rik, 0610010G05Rik, 0610010I05Rik, 0610010I23Rik, 0610010M09Rik, 0610010M22Rik.

Interactions 23

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-21a-5p interacts with:

Interaction id Participant Synonyms
URS000039ED8D_10090-12 A0A0R4J097 A0A0R4J097
URS000039ED8D_10090-14 A0A0R4J097 A0A0R4J097
URS000039ED8D_10090-1 O08586 O08586
URS000039ED8D_10090-0 O08586 O08586
URS000039ED8D_10090-3 O35253 O35253
URS000039ED8D_10090-15 O35253 O35253
URS000039ED8D_10090-16 O35253 O35253
URS000039ED8D_10090-2 O35253 O35253
URS000039ED8D_10090-13 P23204 P23204
URS000039ED8D_10090-4 P41047 P41047
URS000039ED8D_10090-17 P41047 P41047
URS000039ED8D_10090-5 P42227 P42227
URS000039ED8D_10090-18 P52927 P52927
URS000039ED8D_10090-6 P52927 P52927
URS000039ED8D_10090-19 Q61823 Q61823
URS000039ED8D_10090-7 Q61823 Q61823
URS000039ED8D_10090-8 Q61823 Q61823
URS000039ED8D_10090-20 Q9QXV8 Q9QXV8
URS000039ED8D_10090-9 Q9QXV8 Q9QXV8
URS000039ED8D_10090-10 Q9QXV9 Q9QXV9
URS000039ED8D_10090-21 Q9QXV9 Q9QXV9
URS000039ED8D_10090-11 Q9Z0J1 Q9Z0J1
URS000039ED8D_10090-22 Q9Z0J1 Q9Z0J1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGCUUAUCAGACUGAUGUUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Anolis carolinensis (green anole) aca-miR-21-5p
    2. Ateles geoffroyi age-miR-21
    3. Bos taurus microRNA miR-21
    4. Callithrix jacchus cja-miR-21
    5. Canis lupus familiaris (dog) cfa-miR-21
    6. Capra hircus miR-21
    7. Chrysemys picta cpi-miR-21-5p
    8. Columba livia (rock pigeon) cli-miR-21-5p
    9. Cricetulus griseus (Chinese hamster) cgr-miR-21-5p
    10. Equus caballus eca-miR-21
    11. Gallus gallus gga-miR-21-5p
    12. Gorilla gorilla ggo-miR-21
    13. Homo sapiens (human) hsa-miR-21-5p
    14. Macaca mulatta (Rhesus monkey) mml-miR-21-5p
    15. Macaca nemestrina (pig-tailed macaque) mne-miR-21
    16. Monodelphis domestica mdo-miR-21-5p
    17. Ophiophagus hannah oha-miR-21-5p
    18. Ornithorhynchus anatinus oan-miR-21-5p
    19. Ovis aries microRNA miR-21
    20. Pan paniscus ppa-miR-21
    21. Pan troglodytes ptr-miR-21
    22. Pongo pygmaeus ppy-miR-21
    23. Pteropus alecto (black flying fox) pal-miR-21-5p
    24. Rattus norvegicus (Norway rat) rno-miR-21-5p
    25. Sus scrofa (pig) ssc-miR-21-5p
    26. Taeniopygia guttata (zebra finch) tgu-miR-21-5p
    27. Tupaia chinensis tch-miR-21-5p
    28. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2544792
    Publications New