Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca fascicularis (Crab-eating macaque) microRNA 130a (ENSMFAG00000012991.2) URS000039E12D_9541

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUGCUGGCCAGAGCUCUUUUCACAUUGUGCUACUGUCUGCACCUGUCACUAGCAGUGCAAUGUUAAAAGGGCAUUGGCCGUGUAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Aotus nancymaae miRNA (ENSANAG00000014608.1)
  2. Callithrix jacchus miRNA (ENSCJAG00000028944.3)
  3. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000032001.1)
  4. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000022823.1)
  5. Chlorocebus sabaeus (African green monkey) microRNA 130a (ENSCSAG00000024931.1)
  6. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000004598.1)
  7. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-130a (ENSGGOG00000028637.2)
  8. Gorilla gorilla (western gorilla) microRNA ggo-mir-130a precursor
  9. Homo sapiens microRNA hsa-mir-130a precursor
  10. Macaca mulatta mml-mir-130a (ENSMMUG00000027028.3)
  11. Macaca nemestrina microRNA mne-mir-130a precursor
  12. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000014486.1)
  13. Microcebus murinus (gray mouse lemur) microRNA 130a (ENSMICG00000018091.3)
  14. Nomascus leucogenys microRNA 130a (ENSNLEG00000022870.2)
  15. Otolemur garnettii miRNA (ENSOGAG00000017474.1)
  16. Pan paniscus microRNA ppa-mir-130a precursor
  17. Pan troglodytes ptr-mir-130a (ENSPTRG00000027623.2)
  18. Papio anubis (olive baboon) miRNA (ENSPANG00000013660.3)
  19. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000028918.1)
  20. Pongo abelii miRNA (ENSPPYG00000022084.2)
  21. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-130a precursor
  22. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000006344.1)
  23. Propithecus coquereli miRNA (ENSPCOG00000009989.1)
  24. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000009355.1)
  25. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000003502.1)
  26. Theropithecus gelada microRNA 130a (ENSTGEG00000022505.1)
Publications