Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-641 URS000039D790_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-641: Hsa-mir-641 is a human miRNA that is predicted to have targets in close proximity and functional synergy with its host, according to the hypothesis of an interactome feedback circuitry [PMC3091682]. In a study comparing OA chondrocytes and normal chondrocytes, it was found that hsa-mir-641 was up-regulated in normal chondrocytes compared to OA chondrocytes, along with five other miRNAs (hsa-miR-149*, hsa-miR-582-3p, hsa-miR-1227, hsa-miR-634, and hsa-miR-576-5p) [PMC3495209]. However, one miRNA (hsa-miR-483-5p) was up-regulated in OA chondrocytes [PMC3495209]. These findings suggest that hsa-mir-641 may play a role in the regulation of gene expression in chondrocytes and potentially contribute to the pathogenesis of osteoarthritis. Further research is needed to fully understand the functional significance of these miRNAs and their targets.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGACAUAGGAUAGAGUCACCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications