v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bradyrhizobium sp. IC3069 tRNA-Phe secondary structure diagram

Bradyrhizobium sp. IC3069 tRNA-Phe URS0000394D79_2793806

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCCAGGUAGCUCAGUUGGUAGAGCAUGCGACUGAAAAUCGCAGUGUCGGUGGUUCGAUUCCGCCCCUGGGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 678 other species

  1. Roseicella frigidaeris tRNA-Phe
  2. Rhizosaccharibacter radicis Acetobacteraceae bacterium KSS12 tRNA-Phe
  3. Acetobacteraceae bacterium tRNA-Phe
  4. Acidibrevibacterium fodinaquatile tRNA-Phe
  5. Acidiphilium acidophilum tRNA-Phe
  6. Acidiphilium cryptum JF-5 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  7. Acidiphilium iwatense tRNA-Phe
  8. Acidiphilium multivorum AIU301 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  9. Acidiphilium multivorum tRNA-Phe
  10. Acidiphilium rubrum tRNA-Phe
  11. Acidiphilium sp. 20-67-58 tRNA-Phe
  12. Acidiphilium sp. 21-62-4 tRNA-Phe
  13. Acidiphilium sp. 34-64-41 tRNA-Phe
  14. Acidiphilium sp. 37-64-53 tRNA-Phe
  15. Acidiphilium sp. 37-67-22 tRNA-Phe
  16. Acidiphilium sp. JA12-A1 tRNA-Phe
  17. Acidiphilium sp. PA tRNA-Phe
  18. Acidiphilium sp. tRNA-Phe
  19. Acidisphaera sp. tRNA-Phe
  20. Acidobacteriaceae bacterium tRNA-Phe
  21. Acidocella aminolytica 101 = DSM 11237 tRNA_Phe_GAA
  22. Acidocella aromatica tRNA-Phe
  23. Acidocella sp. KAb 2-4 tRNA-Phe
  24. Acidocella sp. tRNA-Phe
  25. Aerococcus urinae tRNA-Phe
  26. Afipia sp. 62-7 tRNA-Phe
  27. Afipia sp. tRNA-Phe
  28. Afipia sp. P52-10 tRNA-Phe
  29. Agaricicola taiwanensis tRNA-Phe
  30. Algihabitans albus tRNA-Phe
  31. Aliidongia dinghuensis tRNA-Phe
  32. Aliidongia sp. tRNA-Phe
  33. Allosphingosinicella sp. tRNA-Phe
  34. Alphaproteobacteria bacterium 65-37 tRNA-Phe
  35. Alphaproteobacteria bacterium (freshwater metagenome) tRNA-Phe
  36. Alphaproteobacteria bacterium HGW-Alphaproteobacteria-11 tRNA-Phe
  37. Alphaproteobacteria bacterium HGW-Alphaproteobacteria-3 tRNA-Phe
  38. Alphaproteobacteria bacterium HGW-Alphaproteobacteria-5 tRNA-Phe
  39. alpha proteobacterium Q-1 tRNA-Phe
  40. Alsobacter ponti tRNA-Phe
  41. Alsobacter soli tRNA-Phe
  42. Alsobacter sp. tRNA-Phe
  43. Croceibacterium atlanticum tRNA-Phe
  44. Altererythrobacter sp. 66-12 tRNA-Phe
  45. Pelagerythrobacter rhizovicinus tRNA-Phe
  46. Altererythrobacter sp. B11 tRNA-Phe
  47. Altererythrobacter sp. (bioreactor metagenome) tRNA-Phe
  48. Altererythrobacter sp. C41 tRNA-Phe
  49. Amorphus orientalis tRNA-Phe
  50. Amorphus sp. 3PC139-8 tRNA-Phe
  51. Methyloraptor flagellatus Ancalomicrobiaceae bacterium S20 tRNA-Phe
  52. Ancylobacter mangrovi tRNA-Phe
  53. Ancylobacter novellus DSM 506 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  54. Aquabacter sp. CN5-332 tRNA-Phe
  55. Aquamicrobium ahrensii tRNA-Phe
  56. Aquamicrobium sp. tRNA-Phe
  57. Aquamicrobium terrae tRNA-Phe
  58. Aquibaculum arenosum tRNA-Phe
  59. Aquibium pacificus tRNA-Phe
  60. Aquibium sp. ELW1220 tRNA-Phe
  61. Antarcticirhabdus aurantiaca tRNA-Phe
  62. Aureimonas endophytica tRNA-Phe
  63. Plantimonas leprariae tRNA-Phe
  64. Azorhizobium caulinodans ORS 571 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  65. Azorhizobium caulinodans tRNA-Phe
  66. Azospirillum brasilense tRNA-Phe
  67. Beijerinckiaceae bacterium tRNA-Phe
  68. Beijerinckia indica subsp. indica ATCC 9039 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  69. Beijerinckia sp. tRNA-Phe
  70. Belnapia arida tRNA-Phe
  71. Belnapia mucosa tRNA-Phe
  72. Belnapia rosea tRNA_Phe_GAA
  73. Bosea eneae tRNA-Phe
  74. Bosea minatitlanensis tRNA-Phe
  75. Bosea sp. 67-29 tRNA-Phe
  76. Bosea sp. ANAM02 tRNA-Phe
  77. Bosea sp. (in: a-proteobacteria) (bioreactor metagenome) tRNA-Phe
  78. Bosea sp. F3-2 tRNA-Phe
  79. Bosea sp. NBC_00550 tRNA-Phe
  80. Bosea caraganae tRNA-Phe
  81. Bosea caraganae tRNA-Phe
  82. Bosea sp. RCC_152_1 tRNA-Phe
  83. Bosea spartocytisi tRNA-Phe
  84. Bosea thiooxidans tRNA_Phe_GAA
  85. Bradyrhizobiaceae bacterium tRNA-Phe
  86. Bradyrhizobium agreste tRNA-Phe
  87. Bradyrhizobium amphicarpaeae tRNA-Phe
  88. Bradyrhizobium arachidis tRNA-Phe
  89. Bradyrhizobium barranii tRNA-Phe
  90. Bradyrhizobium betae tRNA-Phe
  91. Bradyrhizobium cajani tRNA-Phe
  92. Bradyrhizobium canariense tRNA-Phe
  93. Bradyrhizobium cytisi tRNA-Phe
  94. Bradyrhizobium daqingense tRNA-Phe
  95. Bradyrhizobium denitrificans tRNA-Phe
  96. Bradyrhizobium diazoefficiens SEMIA 5080 tRNA-Phe
  97. Bradyrhizobium diazoefficiens tRNA-Phe
  98. Bradyrhizobium diazoefficiens USDA 110 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  99. Bradyrhizobium diversitatis tRNA-Phe
  100. Bradyrhizobium commune tRNA-Phe
  101. Bradyrhizobium genosp. SA-3 tRNA-Phe
  102. Bradyrhizobium guangdongense tRNA-Phe
  103. Bradyrhizobium guangzhouense tRNA-Phe
  104. Bradyrhizobium huanghuaihaiense tRNA-Phe
  105. Bradyrhizobium iriomotense tRNA-Phe
  106. Bradyrhizobium japonicum SEMIA 5079 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  107. Bradyrhizobium japonicum tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  108. Bradyrhizobium japonicum USDA 123 tRNA-Phe
  109. Bradyrhizobium japonicum USDA 135 tRNA-Phe
  110. Bradyrhizobium japonicum USDA 6 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  111. Bradyrhizobium liaoningense tRNA-Phe
  112. Bradyrhizobium lupini tRNA-Phe
  113. Bradyrhizobium manausense tRNA-Phe
  114. Bradyrhizobium neotropicale tRNA-Phe
  115. Bradyrhizobium ontarionense tRNA-Phe
  116. Bradyrhizobium ottawaense tRNA-Phe
  117. Bradyrhizobium rifense tRNA-Phe
  118. Bradyrhizobium shewense tRNA_Phe_GAA
  119. Bradyrhizobium sp. 1(2017) tRNA-Phe
  120. Bradyrhizobium sp. 131 tRNA-Phe
  121. Bradyrhizobium barranii subsp. barranii tRNA-Phe
  122. Bradyrhizobium sp. 145 tRNA-Phe
  123. Bradyrhizobium xenonodulans tRNA-Phe
  124. Bradyrhizobium sp. 155 tRNA-Phe
  125. Bradyrhizobium sp. 160 tRNA-Phe
  126. Bradyrhizobium sp. 164 tRNA-Phe
  127. Bradyrhizobium sp. 171 tRNA-Phe
  128. Bradyrhizobium sp. 172 tRNA-Phe
  129. Bradyrhizobium sp. 179 tRNA-Phe
  130. Bradyrhizobium sp. 183 tRNA-Phe
  131. Bradyrhizobium sp. 184 tRNA-Phe
  132. Bradyrhizobium sp. 186 tRNA-Phe
  133. Bradyrhizobium sp. 187 tRNA-Phe
  134. Bradyrhizobium sp. 191 tRNA-Phe
  135. Bradyrhizobium sp. 192 tRNA-Phe
  136. Bradyrhizobium sp. 195 tRNA-Phe
  137. Bradyrhizobium tunisiense Bradyrhizobium sp. 1AS20L tRNA-Phe
  138. Bradyrhizobium tunisiense Bradyrhizobium sp. 1AS2L tRNA-Phe
  139. Bradyrhizobium tunisiense Bradyrhizobium sp. 1AS5L tRNA-Phe
  140. Bradyrhizobium barranii subsp. apii tRNA-Phe
  141. Bradyrhizobium sp. 31Argb tRNA-Phe
  142. Bradyrhizobium barranii subsp. barranii tRNA-Phe
  143. Bradyrhizobium sp. 35 tRNA-Phe
  144. Bradyrhizobium barranii subsp. apii tRNA-Phe
  145. Bradyrhizobium sp. 40 tRNA-Phe
  146. Bradyrhizobium sp. 4 tRNA-Phe
  147. Bradyrhizobium sp. 62B tRNA-Phe
  148. Bradyrhizobium sp. A11 tRNA-Phe
  149. Bradyrhizobium sp. AC87j1 tRNA-Phe
  150. Bradyrhizobium sp. Arg237L tRNA-Phe
  151. Bradyrhizobium sp. Arg816 tRNA-Phe
  152. Bradyrhizobium sp. AS23.2 tRNA-Phe
  153. Bradyrhizobium hipponense tRNA-Phe
  154. Bradyrhizobium sp. AT1 tRNA-Phe
  155. Bradyrhizobium sp. AZCC 2230 tRNA-Phe
  156. Bradyrhizobium sp. B024 tRNA-Phe
  157. Bradyrhizobium sp. B025 tRNA-Phe
  158. Bradyrhizobium sp. B039 tRNA-Phe
  159. Bradyrhizobium sp. B117 tRNA-Phe
  160. Bradyrhizobium sp. BEA-2-5 tRNA-Phe
  161. Bradyrhizobium centrolobii tRNA-Phe
  162. Bradyrhizobium sp. BR 10261 tRNA-Phe
  163. Bradyrhizobium sacchari tRNA-Phe
  164. Bradyrhizobium sp. BR 10289 tRNA-Phe
  165. Bradyrhizobium sp. BR13661 tRNA-Phe
  166. Bradyrhizobium sp. BRP19 tRNA-Phe
  167. Bradyrhizobium sp. BRP23 tRNA-Phe
  168. Bradyrhizobium sp. BTAi1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  169. Bradyrhizobium sp. BWC-3-1 tRNA-Phe
  170. Bradyrhizobium sp. C-145 tRNA-Phe
  171. Bradyrhizobium sp. CB1015 tRNA-Phe
  172. Bradyrhizobium sp. CB1024 tRNA-Phe
  173. Bradyrhizobium sp. CB1650 tRNA-Phe
  174. Bradyrhizobium sp. CB1717 tRNA-Phe
  175. Bradyrhizobium sp. CB2312 tRNA-Phe
  176. Bradyrhizobium sp. CB3035 tRNA-Phe
  177. Bradyrhizobium sp. CB82 tRNA-Phe
  178. Bradyrhizobium sp. CCBAU 51627 tRNA-Phe
  179. Bradyrhizobium sp. CCBAU 51753 tRNA-Phe
  180. Bradyrhizobium nanningense tRNA-Phe
  181. Bradyrhizobium sp. CCBAU 51765 tRNA-Phe
  182. Bradyrhizobium zhanjiangense tRNA-Phe
  183. Bradyrhizobium zhanjiangense tRNA-Phe
  184. Bradyrhizobium zhanjiangense tRNA-Phe
  185. Bradyrhizobium sp. CCBAU 53338 tRNA-Phe
  186. Bradyrhizobium sp. CCBAU 53340 tRNA-Phe
  187. Bradyrhizobium sp. CCBAU 53351 tRNA-Phe
  188. Bradyrhizobium nanningense tRNA-Phe
  189. Bradyrhizobium sp. CCBAU 53415 tRNA-Phe
  190. Bradyrhizobium guangzhouense tRNA-Phe
  191. Bradyrhizobium guangzhouense tRNA-Phe
  192. Bradyrhizobium sp. CCGE-LA001 tRNA-Phe
  193. Bradyrhizobium sp. cf659 tRNA_Phe_GAA
  194. Bradyrhizobium ivorense tRNA-Phe
  195. Bradyrhizobium ivorense tRNA-Phe
  196. Bradyrhizobium sp. CIAT3101 tRNA-Phe
  197. Bradyrhizobium sp. CIR18 tRNA-Phe
  198. Bradyrhizobium sp. cir1 tRNA-Phe
  199. Bradyrhizobium sp. CIR3A tRNA-Phe
  200. Bradyrhizobium sp. CIR48 tRNA-Phe
  201. Bradyrhizobium frederickii tRNA-Phe
  202. Bradyrhizobium frederickii tRNA-Phe
  203. Bradyrhizobium niftali tRNA-Phe
  204. Bradyrhizobium sp. CSA207 tRNA-Phe
  205. Bradyrhizobium sp. CSS354 tRNA-Phe
  206. Bradyrhizobium sp. CW1 tRNA-Phe
  207. Bradyrhizobium sp. DN5 tRNA-Phe
  208. Bradyrhizobium sp. DOA1 tRNA-Phe
  209. Bradyrhizobium sp. DOA9 tRNA-Phe
  210. Bradyrhizobium sp. ERR14 tRNA-Phe
  211. Bradyrhizobium sp. F1.1.1 tRNA-Phe
  212. Bradyrhizobium sp. F1.13.3 tRNA-Phe
  213. Bradyrhizobium sp. F1.2.1 tRNA-Phe
  214. Bradyrhizobium sp. F1.2.2 tRNA-Phe
  215. Bradyrhizobium sp. F1.2.6 tRNA-Phe
  216. Bradyrhizobium sp. F1.2.8 tRNA-Phe
  217. Bradyrhizobium sp. F1.4.3 tRNA-Phe
  218. Bradyrhizobium sp. F1.6.2 tRNA-Phe
  219. Bradyrhizobium sp. GCM10023180 tRNA-Phe
  220. Bradyrhizobium sp. GCM10023181 tRNA-Phe
  221. Bradyrhizobium sp. GCM10023182 tRNA-Phe
  222. Bradyrhizobium sp. GCM10027634 tRNA-Phe
  223. Bradyrhizobium sp. GCM10027635 tRNA-Phe
  224. Bradyrhizobium sp. GCM10028915 tRNA-Phe
  225. Bradyrhizobium sp. GM2.2 tRNA-Phe
  226. Bradyrhizobium sp. i1.15.2 tRNA-Phe
  227. Bradyrhizobium sp. I1.7.5 tRNA-Phe
  228. Bradyrhizobium sp. I1.8.5 tRNA-Phe
  229. Bradyrhizobium sp. I71 tRNA-Phe
  230. Bradyrhizobium sp. IAR9 tRNA-Phe
  231. Bradyrhizobium sp. IC4060 tRNA-Phe
  232. Bradyrhizobium campsiandrae tRNA-Phe
  233. Bradyrhizobium campsiandrae tRNA-Phe
  234. Bradyrhizobium forestalis tRNA-Phe
  235. Bradyrhizobium sp. ISRA426 tRNA-Phe
  236. Bradyrhizobium sp. ISRA430 tRNA-Phe
  237. Bradyrhizobium sp. ISRA432 tRNA-Phe
  238. Bradyrhizobium sp. ISRA442 tRNA-Phe
  239. Bradyrhizobium sp. JR1.1 tRNA-Phe
  240. Bradyrhizobium sp. JR1.5 tRNA-Phe
  241. Bradyrhizobium sp. JR1.7 tRNA-Phe
  242. Bradyrhizobium sp. JR18.2 tRNA-Phe
  243. Bradyrhizobium sp. JR19.8 tRNA-Phe
  244. Bradyrhizobium sp. JR3.12 tRNA-Phe
  245. Bradyrhizobium sp. JR4.1 tRNA-Phe
  246. Bradyrhizobium sp. JR4.3 tRNA-Phe
  247. Bradyrhizobium sp. JR5.3 tRNA-Phe
  248. Bradyrhizobium sp. JR7.2 tRNA-Phe
  249. Bradyrhizobium sp. LA2.1 tRNA-Phe
  250. Bradyrhizobium sp. LA3.X tRNA-Phe
  251. Bradyrhizobium sp. LA6.10 tRNA-Phe
  252. Bradyrhizobium sp. LA6.12 tRNA-Phe
  253. Bradyrhizobium sp. LA6.1 tRNA-Phe
  254. Bradyrhizobium sp. LA6.3 tRNA-Phe
  255. Bradyrhizobium sp. LA6.4 tRNA-Phe
  256. Bradyrhizobium sp. LA6.7 tRNA-Phe
  257. Bradyrhizobium sp. LA6.8 tRNA-Phe
  258. Bradyrhizobium sp. LA7.1 tRNA-Phe
  259. Bradyrhizobium sp. LA8.1 tRNA-Phe
  260. Bradyrhizobium sp. LB11.1 tRNA-Phe
  261. Bradyrhizobium sp. LB12.1 tRNA-Phe
  262. Bradyrhizobium sp. LB14.3 tRNA-Phe
  263. Bradyrhizobium sp. LB5.2 tRNA-Phe
  264. Bradyrhizobium sp. LB8.2 tRNA-Phe
  265. Bradyrhizobium sp. LCT2 tRNA-Phe
  266. Bradyrhizobium sp. Leaf396 tRNA-Phe
  267. Bradyrhizobium sp. Leo121 tRNA-Phe
  268. Bradyrhizobium sp. Leo170 tRNA-Phe
  269. Bradyrhizobium sp. LHD-71 tRNA-Phe
  270. Bradyrhizobium sp. LLZ17 tRNA-Phe
  271. Bradyrhizobium sp. LTSP849 tRNA-Phe
  272. Bradyrhizobium sp. LTSP857 tRNA-Phe
  273. Bradyrhizobium sp. LVM 105 tRNA-Phe
  274. Bradyrhizobium sp. MOS001 tRNA-Phe
  275. Bradyrhizobium sp. MOS002 tRNA-Phe
  276. Bradyrhizobium sp. MOS003 tRNA-Phe
  277. Bradyrhizobium sp. NAS80.1 tRNA-Phe
  278. Bradyrhizobium sp. NBAIM02 tRNA-Phe
  279. Bradyrhizobium sp. NBAIM14 tRNA-Phe
  280. Bradyrhizobium sp. NBAIM20 tRNA-Phe
  281. Bradyrhizobium sp. NC92 tRNA-Phe
  282. Bradyrhizobium sp. NDS-1 tRNA-Phe
  283. Bradyrhizobium sp. NL2 tRNA-Phe
  284. Bradyrhizobium sp. NP1 tRNA-Phe
  285. Bradyrhizobium sp. ORS 278 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  286. Bradyrhizobium sp. RDM4 tRNA-Phe
  287. Bradyrhizobium sp. RDT46 tRNA-Phe
  288. Bradyrhizobium sp. RP6 tRNA-Phe
  289. Bradyrhizobium sp. RT10b tRNA-Phe
  290. Bradyrhizobium sp. RT11b tRNA-Phe
  291. Bradyrhizobium sp. RT3a tRNA-Phe
  292. Bradyrhizobium sp. RT3b tRNA-Phe
  293. Bradyrhizobium sp. RT4a tRNA-Phe
  294. Bradyrhizobium sp. RT4b tRNA-Phe
  295. Bradyrhizobium sp. RT5a tRNA-Phe
  296. Bradyrhizobium sp. RT6a tRNA-Phe
  297. Bradyrhizobium sp. RT7a tRNA-Phe
  298. Bradyrhizobium sp. RT7b tRNA-Phe
  299. Bradyrhizobium sp. RT9a tRNA-Phe
  300. Bradyrhizobium sp. RT9b tRNA-Phe
  301. Bradyrhizobium sp. S3.12.5 tRNA-Phe
  302. Bradyrhizobium sp. S3.2.12 tRNA-Phe
  303. Bradyrhizobium sp. S3.2.6 tRNA-Phe
  304. Bradyrhizobium sp. S3.3.6 tRNA-Phe
  305. Bradyrhizobium sp. S3.5.5 tRNA-Phe
  306. Bradyrhizobium sp. S3.9.1 tRNA-Phe
  307. Bradyrhizobium sp. S3.9.2 tRNA-Phe
  308. Bradyrhizobium sp. SBR1B tRNA-Phe
  309. Bradyrhizobium sp. SEMIA tRNA-Phe
  310. Bradyrhizobium ottawaense tRNA-Phe
  311. Bradyrhizobium sp. tRNA-Phe
  312. Bradyrhizobium sp. SSUT18 tRNA-Phe
  313. Bradyrhizobium sp. SSUT77 tRNA-Phe
  314. Bradyrhizobium sp. STM 3809 tRNA-Phe
  315. Bradyrhizobium sp. STM 3843 tRNA-Phe
  316. Bradyrhizobium sp. SUTN9-2 tRNA-Phe
  317. Bradyrhizobium sp. TM102 tRNA-Phe
  318. Bradyrhizobium sp. TM233 tRNA-Phe
  319. Bradyrhizobium sp. TM239 tRNA-Phe
  320. Bradyrhizobium nitroreducens tRNA-Phe
  321. Bradyrhizobium sp. UNPA324 tRNA-Phe
  322. Bradyrhizobium sp. UNPF46 tRNA-Phe
  323. Bradyrhizobium sp. USDA 223 tRNA-Phe
  324. Bradyrhizobium sp. USDA 313 tRNA-Phe
  325. Bradyrhizobium sp. USDA 327 tRNA-Phe
  326. Bradyrhizobium sp. USDA 328 tRNA-Phe
  327. Bradyrhizobium sp. USDA 329 tRNA-Phe
  328. Bradyrhizobium sp. USDA 336 tRNA-Phe
  329. Bradyrhizobium sp. vgs-9 tRNA-Phe
  330. Bradyrhizobium sp. WBAH10 tRNA-Phe
  331. Bradyrhizobium sp. WBAH23 tRNA-Phe
  332. Bradyrhizobium sp. WBAH30 tRNA-Phe
  333. Bradyrhizobium sp. WBAH33 tRNA-Phe
  334. Bradyrhizobium sp. WBAH41 tRNA-Phe
  335. Bradyrhizobium sp. WBAH42 tRNA-Phe
  336. Bradyrhizobium sp. WBOS01 tRNA-Phe
  337. Bradyrhizobium sp. WBOS02 tRNA-Phe
  338. Bradyrhizobium sp. WBOS04 tRNA-Phe
  339. Bradyrhizobium sp. WBOS07 tRNA-Phe
  340. Bradyrhizobium sp. WBOS08 tRNA-Phe
  341. Bradyrhizobium sp. WBOS16 tRNA-Phe
  342. Bradyrhizobium sp. WBOS1 tRNA-Phe
  343. Bradyrhizobium sp. WBOS2 tRNA-Phe
  344. Bradyrhizobium sp. WBOS4 tRNA-Phe
  345. Bradyrhizobium sp. WBOS7 tRNA-Phe
  346. Bradyrhizobium sp. WBOS8 tRNA-Phe
  347. Bradyrhizobium sp. WD16 tRNA-Phe
  348. Bradyrhizobium sp. WSM1253 tRNA-Phe
  349. Bradyrhizobium sp. WSM471 tRNA-Phe
  350. Bradyrhizobium sp. WU425 tRNA-Phe
  351. Bradyrhizobium sp. WYCCWR 12677 tRNA-Phe
  352. Bradyrhizobium sp. WYCCWR 12699 tRNA-Phe
  353. Bradyrhizobium sp. WYCCWR 13022 tRNA-Phe
  354. Bradyrhizobium sp. Y36 tRNA-Phe
  355. Bradyrhizobium sp. YCK136 tRNA-Phe
  356. Bradyrhizobium symbiodeficiens tRNA-Phe
  357. Bradyrhizobium vignae tRNA-Phe
  358. Bradyrhizobium yuanmingense tRNA-Phe
  359. Bradyrhizobium zhengyangense tRNA-Phe
  360. Burkholderiales bacterium tRNA-Phe
  361. Caldovatus sediminis tRNA-Phe
  362. Candidatus Rhodoblastus alkanivorans tRNA-Phe
  363. Candidatus Solibacter sp. tRNA-Phe
  364. Chelatococcus albus tRNA-Phe
  365. Chelatococcus reniformis tRNA-Phe
  366. Chelatococcus sp. GCM10030263 tRNA-Phe
  367. Chelatococcus sp. tRNA-Phe
  368. Crenalkalicoccus sp. tRNA-Phe
  369. Croceibacterium sp. tRNA-Phe
  370. Dankookia rubra tRNA-Phe
  371. Dankookia sp. GCM10030260 tRNA-Phe
  372. Defluviicoccus sp. tRNA-Phe
  373. Elioraea tepida tRNA-Phe
  374. Enhydrobacter aerosaccus tRNA_Phe_GAA
  375. Vineibacter terrae tRNA-Phe
  376. Enhydrobacter sp. tRNA-Phe
  377. Enterovirga aerilata tRNA-Phe
  378. Enterovirga sp. tRNA-Phe
  379. Falsiroseomonas frigidaquae tRNA-Phe
  380. Falsiroseomonas sp. tRNA-Phe
  381. Falsiroseomonas tokyonensis tRNA-Phe
  382. Filomicrobium sp. tRNA-Phe
  383. Frankia sp. RB7 tRNA-Phe
  384. freshwater sediment metagenome tRNA-Phe
  385. Futiania mangrovi tRNA-Phe
  386. Gammaproteobacteria bacterium tRNA-Phe
  387. Gemmatimonadales bacterium tRNA-Phe
  388. Hartmannibacter diazotrophicus tRNA-Phe
  389. Hyphomicrobiaceae bacterium TMED74 tRNA-Phe
  390. Hyphomicrobiaceae bacterium tRNA-Phe
  391. Hyphomicrobiales bacterium tRNA-Phe
  392. Hyphomicrobium sp. tRNA-Phe
  393. Hyphomicrobium sp. SCN 65-11 tRNA-Phe
  394. Iodidimonas gelatinilytica tRNA-Phe
  395. Iodidimonas muriae tRNA-Phe
  396. Iodidimonas sp. SYSU 1G8 tRNA-Phe
  397. Jiella flava tRNA-Phe
  398. Jiella sonneratiae tRNA-Phe
  399. Kangiella sp. tRNA-Phe
  400. Kiloniellales bacterium tRNA-Phe
  401. Kordiimonadales bacterium JCM 17843 tRNA-Phe
  402. Iodidimonas nitroreducens tRNA-Phe
  403. Lichenifustis flavocetrariae tRNA-Phe
  404. Limobrevibacterium gyesilva tRNA-Phe
  405. Magnetospirillaceae bacterium tRNA-Phe
  406. Magnetospirillum aberrantis SpK tRNA-Phe
  407. Magnetospirillum gryphiswaldense MSR-1 tRNA-Phe
  408. Magnetospirillum gryphiswaldense MSR-1 v2 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  409. Magnetospirillum gryphiswaldense tRNA-Phe
  410. Paramagnetospirillum marisnigri tRNA-Phe
  411. Magnetospirillum sp. 64-120 tRNA-Phe
  412. Magnetospirillum sulfuroxidans tRNA-Phe
  413. Paramagnetospirillum kuznetsovii tRNA-Phe
  414. Magnetospirillum sp. LM-5 tRNA-Phe
  415. Magnetospirillum sp. ME-1 tRNA-Phe
  416. Magnetospirillum sp. SS-4 tRNA-Phe
  417. Magnetospirillum sp. tRNA-Phe
  418. Magnetospirillum sp. XM-1 tRNA-Phe
  419. Mesorhizobium liriopis tRNA-Phe
  420. Mesorhizobium loti tRNA-Phe
  421. Aquibium oceanicum tRNA-Phe
  422. Mesorhizobium retamae tRNA-Phe
  423. Aquibium carbonis tRNA-Phe
  424. Mesorhizobium sp. tRNA-Phe
  425. Mesorhizobium sp. NPDC059024 tRNA-Phe
  426. Mesorhizobium sp. NPDC059025 tRNA-Phe
  427. Mesorhizobium sp. NPDC059054 tRNA-Phe
  428. Mesorhizobium hungaricum tRNA-Phe
  429. Mesorhizobium sp. UC22_110 tRNA-Phe
  430. Mesorhizobium sp. UC74_2 tRNA-Phe
  431. Mesorhizobium sp. YL-MeA3-2017 tRNA-Phe
  432. Mesorhizobium sp. YL-MPnR-2016 tRNA-Phe
  433. Terribium terrae Mesorhizobium terrae tRNA-Phe
  434. Methylobacteriaceae bacterium (activated sludge metagenome) tRNA-Phe
  435. Methylobacteriaceae bacterium AG10 tRNA-Phe
  436. Methylobacterium aerolatum tRNA-Phe
  437. Methylobacterium brachiatum tRNA_Phe_GAA
  438. Methylobacterium dankookense tRNA-Phe
  439. Methylobacterium durans tRNA-Phe
  440. Methylobacterium fujisawaense tRNA-Phe
  441. Methylobacterium gregans tRNA-Phe
  442. Methylobacterium hispanicum tRNA-Phe
  443. Methylobacterium isbiliense tRNA-Phe
  444. Methylobacterium jeotgali tRNA-Phe
  445. Methylobacterium komagatae tRNA-Phe
  446. Methylobacterium mesophilicum tRNA-Phe
  447. Methylobacterium mesophilicum SR1.6/6 tRNA-Phe
  448. Methylobacterium nodulans ORS 2060 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  449. Methylobacterium nodulans tRNA-Phe
  450. Methylobacterium organophilum tRNA-Phe
  451. Methylobacterium oryzae CBMB20 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  452. Methylobacterium oryzae tRNA-Phe
  453. Methylobacterium oxalidis tRNA-Phe
  454. Methylobacterium persicinum tRNA-Phe
  455. Methylobacterium phyllosphaerae tRNA-Phe
  456. Methylobacterium radiotolerans tRNA-Phe
  457. Methylobacterium radiodurans tRNA-Phe
  458. Methylobacterium sp. 1973 tRNA-Phe
  459. Methylobacterium sp. 2A tRNA-Phe
  460. Methylobacterium sp. 391_Methyba4 tRNA-Phe
  461. Methylobacterium sp. 4-46 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  462. Methylobacterium sp. ARG-1 tRNA-Phe
  463. Methylobacterium sp. BE186 tRNA-Phe
  464. Methylobacterium sp. CB376 tRNA-Phe
  465. Methylobacterium sp. CG08_land_8_20_14_0_20_71_15 tRNA-Phe
  466. Methylobacterium sp. CG09_land_8_20_14_0_10_71_15 tRNA-Phe
  467. Methylobacterium sp. DB1607 tRNA-Phe
  468. Methylobacterium sp. DCY52 tRNA-Phe
  469. Methylobacterium sp. GXF4 tRNA-Phe
  470. Methylobacterium carpenticola tRNA-Phe
  471. Methylobacterium sp. NEAU 140 tRNA-Phe
  472. Methylobacterium sp. NEAU K tRNA-Phe
  473. Methylobacterium sp. OAE512b tRNA-Phe
  474. Methylobacterium sp. OAE515 tRNA-Phe
  475. Methylobacterium sp. P1-11 tRNA-Phe
  476. Methylobacterium sp. PvR107 tRNA-Phe
  477. Methylobacterium sp. R2-1 tRNA-Phe
  478. Methylobacterium symbioticum tRNA-Phe
  479. Methylobacterium sp. tRNA-Phe
  480. Methylobacterium sp. UNC378MF tRNA_Phe_GAA
  481. Methylobacterium sp. UNCCL125 tRNA_Phe_GAA
  482. Methylobacterium sp. XJLW tRNA-Phe
  483. Methylobacterium sp. YL-MPn5-2016 tRNA-Phe
  484. Methylobacterium sp. YL-MPn6-2016 tRNA-Phe
  485. Methylobacterium tardum tRNA-Phe
  486. Methylocapsa sp. D3K7 tRNA-Phe
  487. Methylocapsa polymorpha Methylocapsa sp. RX1 tRNA-Phe
  488. Methylocella silvestris BL2 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  489. Methylocella silvestris tRNA-Phe
  490. Methylocella sp. tRNA-Phe
  491. Methylocella tundrae tRNA-Phe
  492. Methylocystaceae bacterium tRNA-Phe
  493. Methylocystis echinoides tRNA-Phe
  494. Methylocystis hirsuta tRNA-Phe
  495. Methylocystis iwaonis tRNA-Phe
  496. Methylocystis parvus OBBP tRNA-Phe
  497. Methylocystis parvus tRNA-Phe
  498. Methylocystis borbori Methylocystis sp. 9N tRNA-Phe
  499. Methylocystis sp. B8 tRNA-Phe
  500. Methylocystis sp. H4A tRNA-Phe
  501. Methylocystis sp. IM2 tRNA-Phe
  502. Methylocystis sp. IM3 tRNA-Phe
  503. Methylocystis sp. IM4 tRNA-Phe
  504. Methylocystis sp. MitZ-2018 tRNA-Phe
  505. Methylocystis sp. MJC1 tRNA-Phe
  506. Methylocystis sp. SC2 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  507. Methylocystis sp. Sn-Cys tRNA-Phe
  508. Methylocystis sp. tRNA-Phe
  509. Methylorubrum podarium tRNA-Phe
  510. Methylorubrum populi BJ001 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  511. Methylorubrum populi tRNA-Phe
  512. Methylorubrum rhodesianum tRNA-Phe
  513. Methylorubrum rhodinum tRNA-Phe
  514. Methylorubrum sp. DB1722 tRNA-Phe
  515. Methylorubrum thiocyanatum tRNA-Phe
  516. Methylosinus sp. 3S-1 tRNA-Phe
  517. Methylosinus sp. C49 tRNA-Phe
  518. Methylosinus sp. H3A tRNA-Phe
  519. Methylosinus sporium tRNA-Phe
  520. Methylosinus sp. R-45379 tRNA-Phe
  521. Methylosinus sp. Sm6 tRNA-Phe
  522. Methylosinus sp. tRNA-Phe
  523. Methylosinus trichosporium OB3b tRNA-Phe
  524. Methylovirgula ligni tRNA-Phe
  525. Methylovirgula sp. tRNA-Phe
  526. Microbaculum marinisediminis tRNA-Phe
  527. Microvirga aerilata tRNA-Phe
  528. Microvirga aerophila tRNA-Phe
  529. Microvirga arsenatis tRNA-Phe
  530. Microvirga flocculans tRNA-Phe
  531. Microvirga lotononidis tRNA-Phe
  532. Microvirga lupini tRNA-Phe
  533. Microvirga makkahensis tRNA-Phe
  534. Microvirga ossetica tRNA-Phe
  535. Microvirga puerhi tRNA-Phe
  536. Microvirga sp. 17 mud 1-3 tRNA-Phe
  537. Microvirga sp. 3-52 tRNA-Phe
  538. Microvirga alba tRNA-Phe
  539. Microvirga terricola tRNA-Phe
  540. Microvirga sp. CF3016 tRNA-Phe
  541. Microvirga sp. GCM10011540 tRNA-Phe
  542. Microvirga sp. HBU67558 tRNA-Phe
  543. Microvirga thermotolerans tRNA-Phe
  544. Microvirga sp. KLBC 81 tRNA-Phe
  545. Microvirga sp. M2 tRNA-Phe
  546. Microvirga tunisiensis tRNA-Phe
  547. Microvirga mediterraneensis tRNA-Phe
  548. Microvirga terrae tRNA-Phe
  549. Microvirga sp. RSM25 tRNA-Phe
  550. Microvirga sp. tRNA-Phe
  551. Microvirga sp. TS319 tRNA-Phe
  552. Microvirga sp. VF16 tRNA-Phe
  553. Microvirga tunisiensis tRNA-Phe
  554. Microvirga vignae tRNA-Phe
  555. Roseomonas alba tRNA-Phe
  556. Neoroseomonas eburnea tRNA-Phe
  557. Neoroseomonas lacus tRNA-Phe
  558. Neoroseomonas marina tRNA-Phe
  559. Neoroseomonas oryzicola tRNA-Phe
  560. Neoroseomonas terrae tRNA-Phe
  561. Nitrobacteraceae bacterium AZCC 1564 tRNA-Phe
  562. Notoacmeibacter ruber tRNA-Phe
  563. Paeniroseomonas aquatica tRNA-Phe
  564. Paracraurococcus lichenis tRNA-Phe
  565. Paracraurococcus ruber tRNA-Phe
  566. Roseicella aquatilis tRNA-Phe
  567. Paramagnetospirillum magneticum AMB-1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  568. Pararoseomonas baculiformis tRNA-Phe
  569. Roseomonas indoligenes tRNA-Phe
  570. Parvibaculaceae bacterium tRNA-Phe
  571. Parvibaculum lavamentivorans DS-1 tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  572. Parvibaculum sp. (activated sludge metagenome) tRNA-Phe
  573. Parvibaculum sedimenti tRNA-Phe
  574. Magnetospirillum fulvum MGU-K5 tRNA-Phe
  575. Magnetospirillum fulvum tRNA_Phe_GAA
  576. Phaeospirillum tilakii tRNA-Phe
  577. Phreatobacter sp. tRNA-Phe
  578. Plastoroseomonas hellenica tRNA-Phe
  579. Pseudomonadota bacterium (activated sludge metagenome) tRNA-Phe
  580. Stutzerimonas stutzeri tRNA-Phe
  581. Pseudorhodoplanes sp. tRNA-Phe
  582. Pseudoxanthobacter soli DSM 19599 tRNA_Phe_GAA
  583. Pyruvatibacter mobilis tRNA-Phe
  584. Reyranella sp. CPCC 100927 tRNA-Phe
  585. Reyranella sp. tRNA-Phe
  586. Rhabdaerophilum calidifontis tRNA-Phe
  587. Rhizobiales bacterium 24-66-13 tRNA-Phe
  588. Rhizobiales bacterium 32-66-11 tRNA-Phe
  589. Rhizobiales bacterium 35-66-30 tRNA-Phe
  590. Rhizobiales bacterium 39-66-18 tRNA-Phe
  591. Rhizobiales bacterium 65-9 tRNA-Phe
  592. Segnochrobactrum spirostomi tRNA-Phe
  593. Rhizomicrobium sp. tRNA-Phe
  594. Rhodobiaceae bacterium tRNA-Phe
  595. Rhodoblastus acidophilus tRNA-Phe
  596. Rhodoblastus sp. 17X3 tRNA-Phe
  597. Rhodoblastus sphagnicola tRNA-Phe
  598. Rhodoblastus sp. tRNA-Phe
  599. Rhodopila globiformis tRNA-Phe
  600. Rhodopila sp. tRNA-Phe
  601. Rhodoplanes sp. Z2-YC6860 tRNA-Phe
  602. Rhodospirillaceae bacterium tRNA-Phe
  603. Rhodospirillales bacterium 69-11 tRNA-Phe
  604. Rhodospirillales bacterium tRNA-Phe
  605. Rhodovarius sp. tRNA-Phe
  606. Rhodovastum atsumiense tRNA-Phe
  607. Rhodovibrionaceae bacterium tRNA-Phe
  608. Roseiarcus sp. tRNA-Phe
  609. Roseicella aerolata tRNA-Phe
  610. Roseicella sp. DB1501 tRNA-Phe
  611. Roseococcus sp. SYP-B2431 tRNA-Phe
  612. Roseomonas gilardii subsp. gilardii tRNA-Phe
  613. Roseomonas gilardii subsp. rosea tRNA-Phe(gaa)
  614. Roseomonas gilardii tRNA-Phe
  615. Roseomonas mucosa tRNA-Phe(gaa)
  616. Muricoccus pecuniae tRNA-Phe
  617. Roseomonas populi tRNA-Phe
  618. Roseomonas sp. BN140053 tRNA-Phe
  619. Falsiroseomonas selenitidurans tRNA-Phe
  620. Roseomonas sp. CAU 1739 tRNA-Phe
  621. Roseomonas sp. CCTCC AB2023176 tRNA-Phe
  622. Falsiroseomonas bella tRNA-Phe
  623. Roseomonas sp. DSM 102946 tRNA-Phe
  624. Roseomonas sp. FDAARGOS_362 tRNA-Phe
  625. Roseomonas sp. GCM10028921 tRNA-Phe
  626. Roseomonas sp. KE2513 tRNA-Phe
  627. Roseomonas sp. TAS13 tRNA-Phe
  628. Roseomonas sp. tRNA-Phe
  629. Rubrivivax sp. tRNA-Phe
  630. Salinarimonas sp. tRNA-Phe
  631. Siccirubricoccus deserti tRNA-Phe
  632. Siccirubricoccus soli tRNA-Phe
  633. Sphingomicrobium sp. tRNA-Phe
  634. Sphingomonadaceae bacterium tRNA-Phe
  635. Sphingomonas canadensis tRNA-Phe
  636. Sphingomonas sp. CGMCC 1.13658 tRNA-Phe
  637. Sphingomonas horti tRNA-Phe
  638. Sphingomonas sp. tRNA-Phe
  639. Sphingomonas tabacisoli tRNA-Phe
  640. Sphingosinicella microcystinivorans tRNA-Phe
  641. Allosphingosinicella humi tRNA-Phe
  642. Stellaceae bacterium tRNA-Phe
  643. Streptomyces purpurogeneiscleroticus tRNA-Phe
  644. Telmatospirillum siberiense tRNA-Phe
  645. Tepidamorphaceae bacterium tRNA-Phe
  646. type II methanotrophic bacterium tRNA-Phe
  647. uncultured Acetobacteraceae bacterium tRNA-Phe-GAA
  648. uncultured Craurococcus sp. tRNA-Phe-GAA
  649. uncultured Microvirga sp. tRNA-Phe-GAA
  650. Vineibacter sp. tRNA-Phe
  651. Xanthobacteraceae bacterium (activated sludge metagenome) tRNA-Phe
  652. Xanthobacter agilis tRNA-Phe
  653. Xanthobacter aminoxidans tRNA-Phe
  654. Xanthobacter autotrophicus DSM 431 tRNA-Phe
  655. Xanthobacter autotrophicus DSM 597 tRNA-Phe
  656. Xanthobacter autotrophicus NCIMB 11399 tRNA-Phe
  657. Xanthobacter autotrophicus tRNA-Phe
  658. Xanthobacter flavus tRNA-Phe
  659. Xanthobacter sp. AM11 tRNA-Phe
  660. Xanthobacter sp. AM33 tRNA-Phe
  661. Xanthobacter sp. DSM 14517 tRNA-Phe
  662. Xanthobacter sp. DSM 24535 tRNA-Phe
  663. Xanthobacter sp. KR7-225 tRNA-Phe
  664. Xanthobacter sp. KR7-65 tRNA-Phe
  665. Xanthobacter sp. SG518 tRNA-Phe
  666. Xanthobacter sp. SG563 tRNA-Phe
  667. Xanthobacter sp. SG618 tRNA-Phe
  668. Xanthobacter sp. V0B-10 tRNA-Phe
  669. Xanthobacter sp. V0C-6 tRNA-Phe
  670. Xanthobacter sp. V13B-9B tRNA-Phe
  671. Xanthobacter sp. V13C-5 tRNA-Phe
  672. Xanthobacter sp. V13C-7B tRNA-Phe
  673. Xanthobacter sp. V2C-4 tRNA-Phe
  674. Xanthobacter sp. V2C-8 tRNA-Phe
  675. Xanthobacter sp. V3B-7B tRNA-Phe
  676. Xanthobacter sp. V3C-3 tRNA-Phe
  677. Xanthobacter sp. V4C-8 tRNA-Phe
  678. Xanthobacter sp. V8C-5 tRNA-Phe
  679. Xanthobacter sp. VNH20 tRNA-Phe
  680. Xanthobacter sp. VTT E-85237 tRNA-Phe
  681. Xanthobacter sp. VTT E-85238 tRNA-Phe
  682. Xanthobacter sp. VTT E-85239 tRNA-Phe
  683. Xanthobacter sp. VTT E-85240 tRNA-Phe
  684. Xanthobacter sp. VTT E-85241 tRNA-Phe
  685. Xanthobacter sp. VTT E-85242 tRNA-Phe
  686. Xanthobacter sp. YC-JY1 tRNA-Phe
  687. Xanthobacter dioxanivorans tRNA-Phe
  688. Xanthobacter tagetidis DSM 11602 tRNA-Phe
  689. Xanthobacter tagetidis tRNA-Phe
 Relationships New

Molecular Relationships

 2D structure

Loading 2D structure...