v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) microRNA mml-mir-206 precursor URS0000389B41_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCUUCCCGAGGCCACAUGCUUCUUUAUAUCCCCAUAUGGAUUACUUUGCUAUGGAAUGUAAGGAAGUGUGUGGUUUCGGCAAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Cebus imitator microRNA 206 (ENSCCAG00000017460.1)
  2. Cercocebus atys miRNA (ENSCATG00000016993.1)
  3. Chlorocebus sabaeus microRNA 206 (ENSCSAG00000022699.1)
  4. Colobus angolensis palliatus miRNA (ENSCANG00000015822.1)
  5. Gorilla gorilla gorilla (Western Lowland Gorilla) miRNA (ENSGGOG00000038640.1, ENSGGOG00000039483.1)
  6. Homo sapiens microRNA hsa-mir-206 precursor
  7. Macaca fascicularis (Crab-eating macaque) microRNA 206 (ENSMFAG00000011259.2)
  8. Macaca nemestrina microRNA mne-mir-206 precursor
  9. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000011778.1)
  10. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 206 (ENSNLEG00000023990.2)
  11. Pan paniscus microRNA 206 (ENSPPAG00000005260.1)
  12. Pan troglodytes ptr-mir-206 (ENSPTRG00000027821.2)
  13. Papio anubis miRNA (ENSPANG00000010998.3)
  14. Piliocolobus tephrosceles microRNA 206 (ENSPTEG00000007642.1)
  15. Pongo abelii miRNA
  16. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-206 precursor
  17. Rhinopithecus bieti miRNA (ENSRBIG00000000366.1)
  18. Rhinopithecus roxellana microRNA 206 (ENSRROG00000011072.1)
  19. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000009274.1)
  20. Theropithecus gelada microRNA 206 (ENSTGEG00000000562.1)
 Publications