Homo sapiens (human) hsa-miR-4485-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4485-3p URS000038446A_9606

20 nucleotides
6 databases (ENA, GeneCards, LncBase, miRBase, RefSeq, TarBase)
Found in 0 other species
176 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4485: Hsa-mir-4485 is up-regulated in the study [PMC7590212]. The study also mentions the down-regulation of hsa-miR-196a-5p [PMC7590212]. The murine homologues of hsa-miR-1973 and hsa-mir-4485 are not currently found in miR databases, but the corresponding regions on the mASncmtRNAs show sequence identities to human miRs [PMC5295434]. Specifically, the double-stranded region of ASncmtRNAs could potentially give rise to murine homologues of miR-1973, miR-4485-5p, and miR-4485-3p [PMC5295434].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UAACGGCCGCGGUACCCUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications