Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HIF1A antisense RNA 1 (HIF1A-AS1) URS0000382715_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HIF1A-AS1: HIF1A-AS1 is a long non-coding RNA (lncRNA) that plays a role in various biological processes and diseases. It has been found to regulate the proliferation of vascular smooth muscle cells (VSMCs) by upregulating TGF-β1 and contributing to the development of intracranial aneurysms [PMC6969641]. Additionally, down-regulation of HIF1A-AS1 has been shown to reduce ventricular remodeling and improve cardiac function in mice after myocardial I/R injury [PMC8928809]. In non-small cell lung cancer (NSCLC) patients, HIF1A-AS1 has been detected in tumor tissues and serum, along with XIST lncRNA [PMC6794882]. HIF1A-AS1 is found not only in the nucleus but also in the perinuclear cellular compartment, which is different from its expression in other human cell types and tissues. It has been shown that HIF1A-AS1 is strongly connected with VEGFA, a core gene involved in various cellular processes [PMC9054372]. In Li-infected macrophages, HIF1A, HIF1A-AS1, and HIF-A3 transcripts were upregulated [PMC9845402]. Knockdown of HIF-A3 suppressed cell apoptosis induced by TNF-α [PMC6321423]. Furthermore, exosome lncRNA HIF-A3 has been suggested as a potential biomarker for atherosclerosis [PMC7753098]. In the pathology of atherosclerosis, it modulates apoptosis of vascular smooth muscle cells and endothelial cells [PMC7940190]. The expression levels of HIF-A3 were significantly increased in patients with intracranial aneurysms compared to healthy controls [PMC7555693]. Inhibition of HIF-A3 led to reduced expression of HIF-1α and phosphorylated mTOR in hepatocellular carcinoma cell lines [PMC7261383]. Additionally, HIF1A-AS1 knockdown resulted in the inhibition of VEGFA protein expression [PMC9054372].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGCCGCCGGCGCCCUCCAUGGUGAAUCGGUCCCCGCGAUGUCUUCACGGCGGGCGGCCCCCAGGCUCGCUCCGGCCUAAGCGCUGGCUCCCUCCACACGCGGAGAAGAGAAGGAAAGACUACAGUUCAACUGUCAAUUGGUUGAUCACCCGGAUUUUAUCUACACCUUAGCCUAUGGUUGUUCAUCUCGUCUCUGCCUAUGGCCCAUUGACUCCCGGAUCCCAGCUCCAUUCUUCGGUACUUUACGCACCCUGCUUCCAGUACCCCAACCAGAAGAAUAUAUAUAGCAGUUAACUGUCAGCUGGCGAAAAGGAGGAAAAUUCAGGAAGAUAAAAUAGCUGAAUGAAUUAUCCCCGCUCCAGAACGCAGAGGAAAAAUGAAAUGGCCAGACCCAGAUGUUAAAAAUGUGUUCCUUGCUCUUUCCUGCCCUAGCAAGGGCUGUUCCAUGUUUAGGGGAUGAAUGCCGCUGAGAGUAUUAGCAAAAAUACAUGUGUCAUUGAGUCUGAGGAAGAUAACUGAGACAUACAGGUAUUUCUCAUAAUGCAUGUGGGCAUCCAUAGACAUAUUCUUAAAUGGCUUAAGGACUUGGAAACUACCUCUAGGAAACCUGAAACUUGAAUGUUGGUCCACUAGGGAGAAGAAAUGUUCCAUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications