Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3960 URS00003783AB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3960: Hsa-mir-3960 is a microRNA that has been studied in various contexts. In one study, it was predicted that hsa-mir-3960 may fail to target the H19 gene with specific alleles, resulting in the creation of a binding site for other microRNAs [PMC7220275]. In another study, the expression levels of hsa-mir-3960 were found to be unchanged in myocardial infarction (MI) patients compared to controls [PMC7248292]. Additionally, hsa-mir-3960 was found to be strongly downregulated in HIV/HCV+ patients [PMC8615810]. Hsa-mir-3960 was also found to be highly expressed along with other microRNAs in certain miRNA clusters [PMC5029934]. Furthermore, hsa-mir-3960 was found to target specific genes involved in various pathways such as the Hippo signaling pathway and the extracellular matrix interaction pathway [PMC6617112]. In another study, it was observed that hsa-mir-3960 showed competitive binding with certain circRNAs and miRNAs such as hsa-miR-10400-5p [PMC9106453]. However, it is important to note that while all the miRNAs examined were expressed in moDCs (monocyte-derived dendritic cells), hsa-mir-3960 showed no expression in this context [PMC6029031].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGGCGGCGGAGGCGGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications