Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-378b URS0000375E2F_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-378b: Mmu-mir-378b is a microRNA that has been studied in various contexts [PMC6963666]. In one study, it was found that mmu-mir-378b decreased in activity in dendritic cells (DCs) after CpG stimulation, while other miRNAs such as mmu-miR-29a and mmu-miR-222 increased [PMC6963666]. In another study, mmu-mir-378b was found to be downregulated in liver tissues treated with CCl4 compared to the control group [PMC4926493]. Real-time quantitative reverse transcriptional polymerase chain reaction (qRT-PCR) was used to validate the downregulation of mmu-mir-378b [PMC4926493]. Additionally, during chlamydia infection and reinfection, the expression of mmu-mir-378b changed over time, being upregulated at week 1 and then downregulated at week 8 [PMC6379932]. The differential expression of mmu-mir-378b during chlamydia infection was associated with increased pathology and migration of eosinophils/neutrophils [PMC6379932]. Furthermore, in another study on chlamydia reinfection, the downregulation of mmu-mir-378b was associated with the formation of new fibrous tissues and other pathological changes [PMC6379932]. Overall, these studies highlight the dynamic expression pattern and potential functional roles of mmu-mir-378b in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGACUUGGAGUCAGAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications