Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata (lyrate rockcress) aly-miR164c-5p URS0000375D16_59689

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aly-miR164c-5p: Aly-mir164c-5p is a target miRNA that was investigated in a study using stable and unstable reference genes (RGs) to analyze its expression patterns under various stresses or in different tissues [PMC8304282]. The study found that when unstable RGs were used, the expression of aly-mir164c-5p was significantly different compared to when stable RGs were used [PMC8304282]. Specifically, the expression of aly-mir164c-5p was downregulated under different treatments when stable RGs were used compared to the control [PMC8304282]. The accuracy of stable RG expression was verified using qRT-PCR analysis of three miRNAs, including aly-mir164c-5p, which had relatively high abundance [PMC8304282]. The study also aimed to determine suitable RGs for gene-expression normalization and found that the selected RGs were appropriate for normalizing the expression of three target miRNAs, including aly-mir164c-5p [PMC8304282]. However, when unstable RGs were used, the expression levels of aly-mir164c-5p were often misestimated under various treatments compared to stable RGs [PMC8304282]. Furthermore, it was observed that aly-mir164c-5p and two other miRNAs (aly-miR168a-5p and smo-miR396) had high expression levels in stems or seeds but these levels were often misestimated when unstable RGs were used [PMC8304282]. Overall, this study highlights the importance of using appropriate reference genes for accurate estimation of miRNA expression levels.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAAGCAGGGCACGUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Ananas comosus (pineapple) microRNA 164c
  2. Arabidopsis thaliana ath-miR164c-5p
  3. Brassica napus bna-miR164d
  4. Brassica rapa (field mustard) bra-miR164d-5p
  5. Cunninghamia lanceolata (China fir) cln-miR164
  6. Pachycladon cheesemanii Pch-miR164c
Publications