Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-449b URS00003758F0_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-449b: Bta-mir-449b is a microRNA that is increased at day 7 of the estrous cycle and was not detected at day 3 [PMC4156418]. It has been found to potentially regulate PYCR1 and DDIT4, which are involved in cancer progression and angiogenesis [PMC6876490]. Bta-mir-449b, along with bta-miR-34c, has been suggested to have critical roles in inducing cell transformation by BPV E5 [PMC6876490]. It has also been predicted that bta-mir-449b could bind to and regulate the expression of DDIT4 [PMC6876490]. Bta-mir-449b is one of the six down-regulated miRNAs, along with bta-miR-34c, bta-miR-122, bta-miR-195, bta-miR-2425-5p, and bta-miR-2428-3p [PMC6876490]. PYCR1 is a common target of bta-mir-449b along with other miRNAs such as bta-miR34c [PMC6876490]. DDIT4 is also a target shared by both bta-mir449b and bta-miRNA34c [PMC6876490]. BtmammiRNA143 could not be amplified by Taqman probes in this study [PMC6876490]. BtmammiRNA449b shares four targets with btammiRNA34c: ACAD10, DDIT4, PYCR1, and CLDN2 [PMC6876490]. Additionally, three SNPs were found in the seed regions of three different microRNAs including btammiRNA44b in QTL regions associated with protein content and yield [PMC8486775]. Bta-mir-449b is one of the up-regulated miRNAs in the study [PMC4617749]. It has also been identified as a potential target of hub miRNAs in the context of IRAK1 [PMC8433134].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAGUGUAUUGUUAGCUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Capra hircus (goat) chi-miR-449b-5p
  2. Homo sapiens hsa-miR-449b-5p
  3. Macaca mulatta (Rhesus monkey) mml-miR-449b-5p
  4. Pan troglodytes ptr-miR-449b
  5. Pongo pygmaeus ppy-miR-449b
Publications