Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1417 tRNA-Gly secondary structure diagram

Saccharomyces cerevisiae YJM1417 tRNA-Gly URS0000363AF2_1294367

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCGGUUAGUGUAGUGGUUAUCAUCCCACCCUUCCAAGGUGGGGACACGGGUUCGAUUCUCGUACCGCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 151 other species

  1. Eremothecium sinecaudum tRNA-Gly
  2. Fusarium falciforme tRNA-Gly
  3. Kazachstania barnettii transfer RNA-Gly(TCC)
  4. Kazachstania bulderi transfer RNA-Gly(TCC)
  5. Kazachstania exigua tRNA-Gly
  6. Kazachstania saulgeensis tRNA
  7. Lachancea kluyveri NRRL Y-12651 tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  8. Lachancea kluyveri partial transfer RNA
  9. Lachancea mirantina tRNA
  10. Lachancea quebecensis transfer RNA
  11. Lachancea thermotolerans CBS 6340 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  12. Lachancea thermotolerans partial transfer RNA
  13. Saccharomyces arboricola H-6 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  14. Saccharomyces boulardii (nom. inval.) tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  15. Saccharomyces cerevisiae AWRI796 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  16. Saccharomyces cerevisiae (baker's yeast) tRNA-Gly (UCC)
  17. Saccharomyces cerevisiae CBS 7960 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  18. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  19. Saccharomyces cerevisiae CLIB215 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  20. Saccharomyces cerevisiae CLIB324 tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  21. Saccharomyces cerevisiae CLIB382 tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1)
  22. Saccharomyces cerevisiae EC1118 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  23. Saccharomyces cerevisiae EC9-8 tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  24. Saccharomyces cerevisiae FL100 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  25. Saccharomyces cerevisiae FostersB tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  26. Saccharomyces cerevisiae FostersO tRNA
  27. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  28. Saccharomyces cerevisiae Lalvin QA23 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  29. Saccharomyces cerevisiae P283 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  30. Saccharomyces cerevisiae P301 tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  31. Saccharomyces cerevisiae PE-2 tRNA-Gly
  32. Saccharomyces cerevisiae PW5 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  33. Saccharomyces cerevisiae R008 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  34. Saccharomyces cerevisiae R103 tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  35. Saccharomyces cerevisiae RM11-1a tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  36. Saccharomyces cerevisiae S288C tRNA-Gly
  37. Saccharomyces cerevisiae Sigma1278b tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  38. Saccharomyces cerevisiae T73 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  39. Saccharomyces cerevisiae T7 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  40. Saccharomyces cerevisiae UC5 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  41. Saccharomyces cerevisiae UFMG A-905 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  42. Saccharomyces cerevisiae Vin13 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  43. Saccharomyces cerevisiae VL3 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  44. Saccharomyces cerevisiae W303 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  45. Saccharomyces cerevisiae Y10 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  46. Saccharomyces cerevisiae YJM1078 tRNA-Gly
  47. Saccharomyces cerevisiae YJM1083 tRNA-Gly
  48. Saccharomyces cerevisiae YJM1129 tRNA-Gly
  49. Saccharomyces cerevisiae YJM1133 tRNA-Gly
  50. Saccharomyces cerevisiae YJM1190 tRNA-Gly
  51. Saccharomyces cerevisiae YJM1199 tRNA-Gly
  52. Saccharomyces cerevisiae YJM1202 tRNA-Gly
  53. Saccharomyces cerevisiae YJM1208 tRNA-Gly
  54. Saccharomyces cerevisiae YJM1242 tRNA-Gly
  55. Saccharomyces cerevisiae YJM1244 tRNA-Gly
  56. Saccharomyces cerevisiae YJM1248 tRNA-Gly
  57. Saccharomyces cerevisiae YJM1250 tRNA-Gly
  58. Saccharomyces cerevisiae YJM1252 tRNA-Gly
  59. Saccharomyces cerevisiae YJM1273 tRNA-Gly
  60. Saccharomyces cerevisiae YJM1304 tRNA-Gly
  61. Saccharomyces cerevisiae YJM1307 tRNA-Gly
  62. Saccharomyces cerevisiae YJM1311 tRNA-Gly
  63. Saccharomyces cerevisiae YJM1326 tRNA-Gly
  64. Saccharomyces cerevisiae YJM1332 tRNA-Gly
  65. Saccharomyces cerevisiae YJM1336 tRNA-Gly
  66. Saccharomyces cerevisiae YJM1338 tRNA-Gly
  67. Saccharomyces cerevisiae YJM1341 tRNA-Gly
  68. Saccharomyces cerevisiae YJM1342 tRNA-Gly
  69. Saccharomyces cerevisiae YJM1355 tRNA-Gly
  70. Saccharomyces cerevisiae YJM1356 tRNA-Gly
  71. Saccharomyces cerevisiae YJM1381 tRNA-Gly
  72. Saccharomyces cerevisiae YJM1383 tRNA-Gly
  73. Saccharomyces cerevisiae YJM1385 tRNA-Gly
  74. Saccharomyces cerevisiae YJM1386 tRNA-Gly
  75. Saccharomyces cerevisiae YJM1387 tRNA-Gly
  76. Saccharomyces cerevisiae YJM1388 tRNA-Gly
  77. Saccharomyces cerevisiae YJM1389 tRNA-Gly
  78. Saccharomyces cerevisiae YJM1399 tRNA-Gly
  79. Saccharomyces cerevisiae YJM1400 tRNA-Gly
  80. Saccharomyces cerevisiae YJM1401 tRNA-Gly
  81. Saccharomyces cerevisiae YJM1402 tRNA-Gly
  82. Saccharomyces cerevisiae YJM1415 tRNA-Gly
  83. Saccharomyces cerevisiae YJM1418 tRNA-Gly
  84. Saccharomyces cerevisiae YJM1419 tRNA-Gly
  85. Saccharomyces cerevisiae YJM1433 tRNA-Gly
  86. Saccharomyces cerevisiae YJM1434 tRNA-Gly
  87. Saccharomyces cerevisiae YJM1439 tRNA-Gly
  88. Saccharomyces cerevisiae YJM1443 tRNA-Gly
  89. Saccharomyces cerevisiae YJM1444 tRNA-Gly
  90. Saccharomyces cerevisiae YJM1447 tRNA-Gly
  91. Saccharomyces cerevisiae YJM1450 tRNA-Gly
  92. Saccharomyces cerevisiae YJM1460 tRNA-Gly
  93. Saccharomyces cerevisiae YJM1463 tRNA-Gly
  94. Saccharomyces cerevisiae YJM1477 tRNA-Gly
  95. Saccharomyces cerevisiae YJM1478 tRNA-Gly
  96. Saccharomyces cerevisiae YJM1479 tRNA-Gly
  97. Saccharomyces cerevisiae YJM1526 tRNA-Gly
  98. Saccharomyces cerevisiae YJM1527 tRNA-Gly
  99. Saccharomyces cerevisiae YJM1549 tRNA-Gly
  100. Saccharomyces cerevisiae YJM1573 tRNA-Gly
  101. Saccharomyces cerevisiae YJM1574 tRNA-Gly
  102. Saccharomyces cerevisiae YJM1592 tRNA-Gly
  103. Saccharomyces cerevisiae YJM1615 tRNA-Gly
  104. Saccharomyces cerevisiae YJM189 tRNA-Gly
  105. Saccharomyces cerevisiae YJM193 tRNA-Gly
  106. Saccharomyces cerevisiae YJM195 tRNA-Gly
  107. Saccharomyces cerevisiae YJM244 tRNA-Gly
  108. Saccharomyces cerevisiae YJM248 tRNA-Gly
  109. Saccharomyces cerevisiae YJM269 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  110. Saccharomyces cerevisiae YJM270 tRNA-Gly
  111. Saccharomyces cerevisiae YJM271 tRNA-Gly
  112. Saccharomyces cerevisiae YJM320 tRNA-Gly
  113. Saccharomyces cerevisiae YJM326 tRNA-Gly
  114. Saccharomyces cerevisiae YJM428 tRNA-Gly
  115. Saccharomyces cerevisiae YJM450 tRNA-Gly
  116. Saccharomyces cerevisiae YJM451 tRNA-Gly
  117. Saccharomyces cerevisiae YJM453 tRNA-Gly
  118. Saccharomyces cerevisiae YJM456 tRNA-Gly
  119. Saccharomyces cerevisiae YJM470 tRNA-Gly
  120. Saccharomyces cerevisiae YJM541 tRNA-Gly
  121. Saccharomyces cerevisiae YJM554 tRNA-Gly
  122. Saccharomyces cerevisiae YJM555 tRNA-Gly
  123. Saccharomyces cerevisiae YJM627 tRNA-Gly
  124. Saccharomyces cerevisiae YJM681 tRNA-Gly
  125. Saccharomyces cerevisiae YJM682 tRNA-Gly
  126. Saccharomyces cerevisiae YJM683 tRNA-Gly
  127. Saccharomyces cerevisiae YJM689 tRNA-Gly
  128. Saccharomyces cerevisiae YJM693 tRNA-Gly
  129. Saccharomyces cerevisiae YJM969 tRNA-Gly
  130. Saccharomyces cerevisiae YJM972 tRNA-Gly
  131. Saccharomyces cerevisiae YJM975 tRNA-Gly
  132. Saccharomyces cerevisiae YJM978 tRNA-Gly
  133. Saccharomyces cerevisiae YJM981 tRNA-Gly
  134. Saccharomyces cerevisiae YJM984 tRNA-Gly
  135. Saccharomyces cerevisiae YJM987 tRNA-Gly
  136. Saccharomyces cerevisiae YJM990 tRNA-Gly
  137. Saccharomyces cerevisiae YJM993 tRNA-Gly
  138. Saccharomyces cerevisiae YJM996 tRNA-Gly
  139. Saccharomyces cerevisiae YJSH1 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  140. Saccharomyces eubayanus tRNA-Gly
  141. Saccharomyces kudriavzevii IFO 1802 tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  142. Saccharomyces kudriavzevii ZP591 tRNA-Gly
  143. Saccharomyces mikatae IFO 1815 tRNA-Gly
  144. Saccharomyces pastorianus tRNA-Gly
  145. Saccharomyces uvarum tRNA-Gly
  146. Tetrapisispora phaffii CBS 4417 tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  147. Torulaspora globosa tRNA-Gly
  148. Torulaspora sp. CBS 2947 tRNA-Gly
  149. Vanderwaltozyma polyspora DSM 70294 tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  150. Vector YCy2508 tRNA-Gly
  151. Zygotorulaspora mrakii tRNA-Gly
2D structure