Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-382 URS000035E174_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAGUUGUUCGUGGUGGAUUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-382
  2. Callithrix jacchus cja-miR-382
  3. Canis lupus familiaris Cfa-Mir-154-P10_5p (mature (co-guide))
  4. Capra hircus chi-miR-382-5p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-382-5p
  6. Cricetulus griseus cgr-miR-382
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-382-5p
  8. Echinops telfairi Ete-Mir-154-P10_5p (mature (guide))
  9. Equus caballus (horse) eca-miR-382
  10. Homo sapiens (human) hsa-miR-382-5p
  11. Macaca mulatta (Rhesus monkey) mml-miR-382-5p
  12. Mus musculus (house mouse) mmu-miR-382-5p
  13. Oryctolagus cuniculus (rabbit) ocu-miR-382-5p
  14. Ovis aries oar-miR-382-5p
  15. Pan troglodytes ptr-miR-382
  16. Pteropus alecto (black flying fox) pal-miR-382-5p
  17. Rattus norvegicus rno-miR-382-5p