Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ananas comosus (pineapple) osa-miR159b URS000035D5E3_4615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGAUUGAAGGGAGCUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Brachypodium distachyon bdi-miR159b-3p.1
  2. Cynara cardunculus var. scolymus cca-miR159e
  3. Hordeum vulgare (barley) hvu-miR159b
  4. Lolium arundinaceum (tall fescue) far-miR159
  5. Oryza sativa (Asian cultivated rice) osa-miR159b
  6. Oryza sativa Japonica Group microRNA osa-miR159b
  7. Saccharum officinarum (sugarcane) sof-miR159b
  8. Saccharum sp. ssp-miR159a
  9. Sorghum bicolor sbi-miR159a
  10. Triticum aestivum (bread wheat) tae-miR159a
  11. Zea mays (maize) zma-miR159k-3p