Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-18a-5p URS000035CC3E_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (PSICQUIC, IntAct, miRBase, MirGeneDB, MalaCards, GeneCards, ENA, RefSeq, LncBase, TarBase). Described in 74 papers. Homo sapiens (human) hsa-miR-18a-5p sequence is a product of hsa-miR-18a, miR-18, MIR18A, miR-18a, miR-18a-5p, hsa-miR-18a-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1700010H15RiK, 182-FIP, 2700066J21Rik, 3'HEXO, 30ST3B1, 3OST3B1, 4832404P21Rik, 5'OY11.1, 82-FIP, A121.

Interactions 13

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-18a-5p interacts with:

Interaction id Participant Synonyms
EBI-21283971 intact:EBI-21283979 EBI-21283979 ENST00000342988 mrna_smad4
URS000035CC3E_9606-6 P31994 P31994
URS000035CC3E_9606-0 P31994 P31994
URS000035CC3E_9606-1 Q13485 Q13485
URS000035CC3E_9606-7 Q13485 Q13485
URS000035CC3E_9606-8 Q13485 Q13485
URS000035CC3E_9606-2 Q13485 Q13485
URS000035CC3E_9606-9 Q15796 Q15796
URS000035CC3E_9606-3 Q15796 Q15796
URS000035CC3E_9606-4 Q8NFP9 Q8NFP9
URS000035CC3E_9606-10 Q8NFP9 Q8NFP9
URS000035CC3E_9606-5 Q9NZV1 Q9NZV1
URS000035CC3E_9606-11 Q9NZV1 Q9NZV1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAGGUGCAUCUAGUGCAGAUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 53 other species

    1. Alligator mississippiensis ami-miR-18-5p
    2. Anolis carolinensis aca-miR-18a-5p
    3. Bos taurus (cattle) Bta-Mir-17-P2a_5p (mature (guide))
    4. Callorhinchus milii (elephant shark) eshark_mir-17_9
    5. Canis lupus familiaris Cfa-Mir-17-P2a_5p (mature (guide))
    6. Capra hircus chi-miR-18a-5p
    7. Cavia porcellus (domestic guinea pig) cpo-miR-18a-5p
    8. Chrysemys picta bellii Cpi-Mir-17-P2a_5p (mature (guide))
    9. Columba livia (rock pigeon) Cli-Mir-17-P2a_5p (mature (guide))
    10. Cricetulus griseus cgr-miR-18a-5p
    11. Cyprinus carpio ccr-miR-18a
    12. Danio rerio (zebrafish) Dre-Mir-17-P2a1_5p (mature (guide))
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-18a-5p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-17-P2a_5p (mature (guide))
    15. Equus caballus (horse) eca-miR-18a
    16. Gallus gallus (chicken) Gga-Mir-17-P2a_5p (mature (guide))
    17. Macaca mulatta Mml-Mir-17-P2a_5p (mature (guide))
    18. Microcebus murinus mmr-miR-18
    19. Monodelphis domestica Mdo-Mir-17-P2a_5p (mature (guide))
    20. Mus musculus (house mouse) mmu-miR-18a-5p
    21. Ophiophagus hannah oha-miR-18a-5p
    22. Oreochromis niloticus oni-miR-18a-2
    23. Ornithorhynchus anatinus Oan-Mir-17-P2a_5p (mature (guide))
    24. Oryctolagus cuniculus (rabbit) ocu-miR-18a-5p
    25. Oryzias latipes (Japanese medaka) ola-miR-18
    26. Otolemur garnettii oga-miR-18
    27. Petromyzon marinus pma-miR-18a-5p
    28. Python bivittatus pbv-miR-18a-5p
    29. Rattus norvegicus rno-miR-18a-5p
    30. Sarcophilus harrisii Sha-Mir-17-P2a_5p (mature (guide))
    31. Scyliorhinus torazame (cloudy catshark) Sto-Mir-17-P2a_5p (mature (guide))
    32. Taeniopygia guttata (zebra finch) Tgu-Mir-17-P2a_5p (mature (guide))
    33. Xenopus tropicalis xtr-miR-18a-5p