Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-18a-5p URS000035CC3E_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, TarBase, MirGeneDB, ENA, miRBase, LncBase, PirBase). Described in 34 papers. Mus musculus (house mouse) mmu-miR-18a-5p sequence is a product of Mir18, miR-18a-5p, mmu-miR-18a, mmu-miR-18a-5p, miR-18a, miR-18 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007L01Rik, 0610007P14Rik, 0610009K11Rik, 0610009M14Rik, 0610010I20Rik, 0610011H04Rik, 0610012A05Rik, 0610013E23Rik, 0610020I02Rik, 0610027D24Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAGGUGCAUCUAGUGCAGAUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 53 other species

    1. Alligator mississippiensis ami-miR-18-5p
    2. Anolis carolinensis aca-miR-18a-5p
    3. Bos taurus (cattle) Bta-Mir-17-P2a_5p (mature (guide))
    4. Callorhinchus milii (elephant shark) eshark_mir-17_9
    5. Canis lupus familiaris Cfa-Mir-17-P2a_5p (mature (guide))
    6. Capra hircus chi-miR-18a-5p
    7. Cavia porcellus (domestic guinea pig) cpo-miR-18a-5p
    8. Chrysemys picta bellii Cpi-Mir-17-P2a_5p (mature (guide))
    9. Columba livia (rock pigeon) Cli-Mir-17-P2a_5p (mature (guide))
    10. Cricetulus griseus cgr-miR-18a-5p
    11. Cyprinus carpio ccr-miR-18a
    12. Danio rerio (zebrafish) Dre-Mir-17-P2a1_5p (mature (guide))
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-18a-5p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-17-P2a_5p (mature (guide))
    15. Equus caballus (horse) eca-miR-18a
    16. Gallus gallus (chicken) Gga-Mir-17-P2a_5p (mature (guide))
    17. Homo sapiens hsa-miR-18a-5p
    18. Macaca mulatta Mml-Mir-17-P2a_5p (mature (guide))
    19. Microcebus murinus mmr-miR-18
    20. Monodelphis domestica Mdo-Mir-17-P2a_5p (mature (guide))
    21. Ophiophagus hannah oha-miR-18a-5p
    22. Oreochromis niloticus oni-miR-18a-2
    23. Ornithorhynchus anatinus Oan-Mir-17-P2a_5p (mature (guide))
    24. Oryctolagus cuniculus (rabbit) ocu-miR-18a-5p
    25. Oryzias latipes (Japanese medaka) ola-miR-18
    26. Otolemur garnettii oga-miR-18
    27. Petromyzon marinus pma-miR-18a-5p
    28. Python bivittatus pbv-miR-18a-5p
    29. Rattus norvegicus rno-miR-18a-5p
    30. Sarcophilus harrisii Sha-Mir-17-P2a_5p (mature (guide))
    31. Scyliorhinus torazame (cloudy catshark) Sto-Mir-17-P2a_5p (mature (guide))
    32. Taeniopygia guttata (zebra finch) Tgu-Mir-17-P2a_5p (mature (guide))
    33. Xenopus tropicalis xtr-miR-18a-5p