Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Linum usitatissimum (flax) lus-miR394b URS0000359C77_4006

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGCAUUCUGUCCACCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Aegilops tauschii ata-miR394-5p
  2. Amborella trichopoda atr-miR394
  3. Ananas comosus microRNA 394c
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR394a-5p
  5. Arabidopsis thaliana (thale cress) ath-miR394b-5p
  6. Arachis hypogaea ahy-miR394
  7. Asparagus officinalis (garden asparagus) aof-miR394
  8. Brachypodium distachyon bdi-miR394
  9. Brassica napus (rape) bna-miR394a
  10. Carica papaya (papaya) cpa-miR394a
  11. Citrus sinensis (sweet orange) csi-miR394b-5p
  12. Corchorus capsularis (jute) sRNA CCACVL1_02652
  13. Corchorus olitorius ahy-miR3
  14. Cucumis melo cme-miR394b
  15. Cynara cardunculus (wild artichoke) cca-miR394
  16. Fragaria vesca subsp. vesca fve-miR394
  17. Glycine max (soybean) gma-miR394g
  18. Gossypium hirsutum ghr-miR394a
  19. Malus domestica mdm-miR394a
  20. Manihot esculenta (cassava) mes-miR394a
  21. Nicotiana tabacum nta-miR394
  22. Oryza sativa (Asian cultivated rice) osa-miR394
  23. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR394
  24. Pachycladon cheesemanii Pch-miR394a
  25. Pachycladon fastigiatum Pfa-miR394a
  26. Picea abies pab-miR394c
  27. Populus tomentosa Pto-miR394b-5p
  28. Populus trichocarpa ptc-miR394b-5p
  29. Prunus persica (peach) ppe-miR394a
  30. Rosa chinensis ath-miR394a
  31. Salvia sclarea (clary) ssl-miR394
  32. Solanum lycopersicum (tomato) sly-miR394-5p
  33. Solanum tuberosum (potato) stu-miR384-5p
  34. Sorghum bicolor sbi-miR394a
  35. Theobroma cacao tcc-miR394a
  36. Vitis vinifera vvi-miR394b
  37. Zea mays (maize) zma-miR394b-5p
Publications