Aedes aegypti (yellow fever mosquito) Aae-Mir-67-v2_5p* (star (passenger))

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aedes aegypti (yellow fever mosquito) Aae-Mir-67-v2_5p* (star (passenger)) URS00003591F6_7159

22 nucleotides
1 database (MirGeneDB)
Found in 10 other species

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACUCACUCAACCUGGGUGUGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Anopheles gambiae (African malaria mosquito) Aga-Mir-67-v2_5p* (star (passenger))
Dinoponera quadriceps dqu-miR-307-5p
Drosophila ananassae Dan-Mir-67-v2_5p* (star (passenger))
Drosophila melanogaster dme-miR-307a-5p
Drosophila mojavensis Dmo-Mir-67-v2_5p* (star (passenger))
Drosophila simulans Dsi-Mir-67-v2_5p* (star (passenger))
Drosophila yakuba Dya-Mir-67-v2_5p* (star (passenger))
Glossina pallidipes (tsetse fly) Gpa-Mir-67-P12-v2_5p* (star (passenger))
Heliconius melpomene (postman butterfly) Hme-Mir-67-v2_5p* (star (passenger))
Tribolium castaneum Tca-Mir-67-v2_5p* (star (passenger))

Relationships