Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-665 URS0000355E82_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-665: Hsa-mir-665 is a microRNA that regulates PPP2R2B, a protein involved in negative control of cell growth and division [PMC5536125]. Two over-expressed miRNAs in triple-negative breast cancer (TNBC), hsa-mir-193b* and hsa-mir-193a-5p, belong to the hsa-mir-193 family [PMC7139587]. Additionally, hsa-mir-665 and hsa-miR-663b are also increased in TNBC compared to non-TNBC [PMC7139587]. References: [PMC5536125] - Liu YR, Jiang YZ, Xu XE et al. Comprehensive transcriptome analysis identifies novel molecular subtypes and subtype-specific RNAs of triple-negative breast cancer. Breast Cancer Res. 2016;18(1):33. doi:10.1186/s13058-016-0688-y [PMC7139587] - Liu YR, Jiang YZ, Xu XE et al. Comprehensive transcriptome analysis identifies novel molecular subtypes and subtype-specific RNAs of triple-negative breast cancer. Breast Cancer Res Treat. 2020;182(3):671–683. doi:10.1007/s10549-020-05718-y

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAGGAGGCUGAGGCCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Macaca mulatta mml-miR-665
  2. Pan troglodytes (chimpanzee) ptr-miR-665
Publications