Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Eisenia fetida (common brandling worm) Efe-Mir-375_3p (mature (guide)) URS000035563D_6396

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGUUCGUUCGGCUCGCGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 39 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-375_3p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-375-3p
  3. Chrysemys picta bellii (western painted turtle) Cpi-Mir-375_3p (mature (guide))
  4. Chrysemys picta cpi-miR-375-3p
  5. Columba livia cli-miR-375-3p
  6. Cyprinus carpio ccr-miR-375
  7. Danio rerio (zebrafish) dre-miR-375
  8. Euprymna scolopes Esc-Mir-375_3p (mature (guide))
  9. Gadus morhua (Atlantic cod) gmo-miR-375-3p
  10. Gallus gallus gga-miR-375
  11. Gekko japonicus Gja-Mir-375_3p (mature (guide))
  12. Haplochromis burtoni abu-miR-375
  13. Latimeria chalumnae Lch-Mir-375_3p (mature (guide))
  14. Lepisosteus oculatus Loc-Mir-375_3p (mature (guide))
  15. Lingula anatina Lan-Mir-375_3p (mature (guide))
  16. Lottia gigantea (owl limpet) lgi-miR-375
  17. Maylandia zebra (zebra mbuna) mze-miR-375
  18. Melibe leonina mle-miR-375-3p
  19. Microcaecilia unicolor Mun-Mir-375-P7b_3p (mature (guide))
  20. Monopterus albus Mal-Mir-375-P2_3p (mature (guide))
  21. Mus musculus Mus_musculus piRNA piR-mmu-50877049
  22. Nautilus pompilius Npo-Mir-375_3p (mature (guide))
  23. Neolamprologus brichardi (lyretail cichlid) nbr-miR-375
  24. Octopus bimaculoides Obi-Mir-375_3p (mature (guide))
  25. Octopus vulgaris (common octopus) Ovu-Mir-375_3p (mature (guide))
  26. Ophiophagus hannah oha-miR-375-3p
  27. Oreochromis niloticus (Nile tilapia) oni-miR-375
  28. Petromyzon marinus (sea lamprey) pma-miR-375a-3p
  29. Pundamilia nyererei pny-miR-375
  30. Python bivittatus pbv-miR-375-3p
  31. Salmo salar ssa-miR-375-3p
  32. Scyliorhinus torazame Sto-Mir-375_3p (mature (guide))
  33. Sphenodon punctatus Spt-Mir-375_3p (mature (guide))
  34. Taeniopygia guttata tgu-miR-375
  35. Takifugu rubripes fru-miR-375
  36. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-375
  37. Tor tambroides miR-375
  38. Xenopus laevis Xla-Mir-375-P14_3p (mature (guide))
  39. Xenopus tropicalis (tropical clawed frog) xtr-miR-375