Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4521 URS000034E58D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4521: Hsa-mir-4521 is a microRNA that has been evaluated in patients with focal cortical dysplasia (FCD) and a control group, using temporal cortex tissue and serum samples [PMC7824581]. It has been suggested that hsa-mir-4521 may have an antiviral role during Newcastle disease virus (NDV) infection in HeLa cells [PMC8211993]. In the context of hypoxia, multiple miRNAs were found to be deregulated in different cell lines [PMC8202010]. In Caco-2 cells, five miRNAs (hsa-miR-27b-5p, hsa-miR-148a-3p, hsa-miR-200a-5p, hsa-miR-1260a, and hsa-miR-1260b) were affected [PMC8202010]. In HT-29 cells, four miRNAs (hsa-let-7a-3p, hsa-miR-22-3p, hsa-miR-615-3p, and hsa-mir-4521) were identified as being deregulated [PMC8202010]. In an experimental study using HeLa cells transfected with plasmids and miRNA mimics or inhibitors, the role of hsa-mir-4521 was investigated [PMC8211993]. Finally, a risk score formula was developed using multiple miRNAs including hsa-mir-501 and hsa-mir-5091 [PMC6089101]. Overall, these findings suggest that Hsa-mir-4521 may have various roles in different cellular contexts including antiviral activity during infection and potential involvement in disease risk assessment [PMC7824581][PMC8211993][PMC8202010][PMC6089101].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUAAGGAAGUCCUGUGCUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications