Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00003460A5_559292

  • 78 nucleotides
  • 4 databases (ENA, IntAct, RefSeq, SGD)
  • Found in 98 species
  • ncRNA

Automated summary: This sRNA sequence is 78 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (RefSeq, SGD, IntAct, ENA). Described in 29 papers. Has a conserved secondary structure or a structured region. Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR59 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 2

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-10960829 URS00004BEF81_559292 EBI-10821555 URS00004BEF81_559292 rrna 35s yeast
EBI-15097059 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUUAAUGAUGAAAACUAUUCCUUAUUCUCGACUAGUCUUUGACAAUGCUGUCGUUUAAUCACCAUCUUUCGGCUGACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 97 other species

    1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR59
    2. Saccharomyces cerevisiae EC1118 SNR59
    3. Saccharomyces cerevisiae Kyokai no. 7 K7_snR59
    4. Saccharomyces cerevisiae P301 SNR59
    5. Saccharomyces cerevisiae PE-2 SNR59
    6. Saccharomyces cerevisiae YJM1078 SNR59
    7. Saccharomyces cerevisiae YJM1083 SNR59
    8. Saccharomyces cerevisiae YJM1129 SNR59
    9. Saccharomyces cerevisiae YJM1133 SNR59
    10. Saccharomyces cerevisiae YJM1190 SNR59
    11. Saccharomyces cerevisiae YJM1199 SNR59
    12. Saccharomyces cerevisiae YJM1202 SNR59
    13. Saccharomyces cerevisiae YJM1208 SNR59
    14. Saccharomyces cerevisiae YJM1242 SNR59
    15. Saccharomyces cerevisiae YJM1244 SNR59
    16. Saccharomyces cerevisiae YJM1248 SNR59
    17. Saccharomyces cerevisiae YJM1250 SNR59
    18. Saccharomyces cerevisiae YJM1252 SNR59
    19. Saccharomyces cerevisiae YJM1273 SNR59
    20. Saccharomyces cerevisiae YJM1304 SNR59
    21. Saccharomyces cerevisiae YJM1307 SNR59
    22. Saccharomyces cerevisiae YJM1311 SNR59
    23. Saccharomyces cerevisiae YJM1326 SNR59
    24. Saccharomyces cerevisiae YJM1332 SNR59
    25. Saccharomyces cerevisiae YJM1336 SNR59
    26. Saccharomyces cerevisiae YJM1338 SNR59
    27. Saccharomyces cerevisiae YJM1341 SNR59
    28. Saccharomyces cerevisiae YJM1342 SNR59
    29. Saccharomyces cerevisiae YJM1355 SNR59
    30. Saccharomyces cerevisiae YJM1356 SNR59
    31. Saccharomyces cerevisiae YJM1381 SNR59
    32. Saccharomyces cerevisiae YJM1383 SNR59
    33. Saccharomyces cerevisiae YJM1385 SNR59
    34. Saccharomyces cerevisiae YJM1386 SNR59
    35. Saccharomyces cerevisiae YJM1387 SNR59
    36. Saccharomyces cerevisiae YJM1388 SNR59
    37. Saccharomyces cerevisiae YJM1389 SNR59
    38. Saccharomyces cerevisiae YJM1399 SNR59
    39. Saccharomyces cerevisiae YJM1400 SNR59
    40. Saccharomyces cerevisiae YJM1401 SNR59
    41. Saccharomyces cerevisiae YJM1402 SNR59
    42. Saccharomyces cerevisiae YJM1415 SNR59
    43. Saccharomyces cerevisiae YJM1417 SNR59
    44. Saccharomyces cerevisiae YJM1418 SNR59
    45. Saccharomyces cerevisiae YJM1419 SNR59
    46. Saccharomyces cerevisiae YJM1433 SNR59
    47. Saccharomyces cerevisiae YJM1434 SNR59
    48. Saccharomyces cerevisiae YJM1439 SNR59
    49. Saccharomyces cerevisiae YJM1443 SNR59
    50. Saccharomyces cerevisiae YJM1444 SNR59
    51. Saccharomyces cerevisiae YJM1447 SNR59
    52. Saccharomyces cerevisiae YJM1450 SNR59
    53. Saccharomyces cerevisiae YJM1460 SNR59
    54. Saccharomyces cerevisiae YJM1463 SNR59
    55. Saccharomyces cerevisiae YJM1477 SNR59
    56. Saccharomyces cerevisiae YJM1478 SNR59
    57. Saccharomyces cerevisiae YJM1479 SNR59
    58. Saccharomyces cerevisiae YJM1526 SNR59
    59. Saccharomyces cerevisiae YJM1527 SNR59
    60. Saccharomyces cerevisiae YJM1549 SNR59
    61. Saccharomyces cerevisiae YJM1573 SNR59
    62. Saccharomyces cerevisiae YJM1574 SNR59
    63. Saccharomyces cerevisiae YJM1592 SNR59
    64. Saccharomyces cerevisiae YJM1615 SNR59
    65. Saccharomyces cerevisiae YJM189 SNR59
    66. Saccharomyces cerevisiae YJM193 SNR59
    67. Saccharomyces cerevisiae YJM244 SNR59
    68. Saccharomyces cerevisiae YJM248 SNR59
    69. Saccharomyces cerevisiae YJM270 SNR59
    70. Saccharomyces cerevisiae YJM271 SNR59
    71. Saccharomyces cerevisiae YJM320 SNR59
    72. Saccharomyces cerevisiae YJM326 SNR59
    73. Saccharomyces cerevisiae YJM428 SNR59
    74. Saccharomyces cerevisiae YJM450 SNR59
    75. Saccharomyces cerevisiae YJM451 SNR59
    76. Saccharomyces cerevisiae YJM453 SNR59
    77. Saccharomyces cerevisiae YJM456 SNR59
    78. Saccharomyces cerevisiae YJM470 SNR59
    79. Saccharomyces cerevisiae YJM541 SNR59
    80. Saccharomyces cerevisiae YJM554 SNR59
    81. Saccharomyces cerevisiae YJM555 SNR59
    82. Saccharomyces cerevisiae YJM627 SNR59
    83. Saccharomyces cerevisiae YJM681 SNR59
    84. Saccharomyces cerevisiae YJM682 SNR59
    85. Saccharomyces cerevisiae YJM683 SNR59
    86. Saccharomyces cerevisiae YJM689 SNR59
    87. Saccharomyces cerevisiae YJM693 SNR59
    88. Saccharomyces cerevisiae YJM969 SNR59
    89. Saccharomyces cerevisiae YJM972 SNR59
    90. Saccharomyces cerevisiae YJM975 SNR59
    91. Saccharomyces cerevisiae YJM978 SNR59
    92. Saccharomyces cerevisiae YJM981 SNR59
    93. Saccharomyces cerevisiae YJM984 SNR59
    94. Saccharomyces cerevisiae YJM987 SNR59
    95. Saccharomyces cerevisiae YJM990 SNR59
    96. Saccharomyces cerevisiae YJM993 SNR59
    97. Saccharomyces cerevisiae YJM996 SNR59
    2D structure New