Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-34a precursor URS000033F823_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR34A: MIR34A is found to be downregulated in gastric cancer cell lines, such as BGC-823, compared to normal gastric epithelium cell lines [PMC4650715]. It has been suggested that MYCN downregulates MIR34A, similar to the action of c-Myc in colon carcinoma cells [PMC6048510]. MIR34A upregulation in T cells may explain the increased induction and activated state of T cells [PMC5351619]. The expression patterns of mature MIR34A differ from pri-MIR34A in METTL3-knockdown and METTL3-overexpressing cells [PMC7347714]. MIR34A is needed to repress Lef-1 post-transcriptionally along with miR-223 [PMC6282069]. The head-to-head orientation of the MIR34A HG and lncTAM34a allows for direct binding and targeting by sequence complementarity between the RNA and promoter DNA [PMC6030072]. Disruption of both TP53 and MIR34A is associated with poor survival in cancer patients [PMC4039115]. MIR34A negatively regulates dendrite outgrowth, while miR-124 positively regulates axonal and dendritic branching [PMC5928558]. The regulation of MHC-I by MIR34A in hippocampal neurons still needs further investigation [PMC7655649]. Co-administration of MIR34A with Dox inhibits invasion and migration in breast cancer cells [PMC8463267].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Publications