Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00003377F1_559292

Automated summary: This snoRNA sequence is 201 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (IntAct, SGD, RefSeq, ENA). Described in 36 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR81, RF01246). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR81 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 2

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-11790096 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-15097082 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGGUUAGGGACUGCAAAAGAAGCGGCGAGGCAGCCCACAUCAAGUGGAACUACACAGACUUCCUUGUCGCGAUACUACGGUCCCAAGAGCAAUCCUAACAAGCAAUUACAUAUUCCCCCGCUGAACCUGUACAGUCCACGGAUGGUGCAGAAGUUAUAUGAUUUGGGGGAAGACGCUUUUUCACAUCUUCUUGCAUGAUAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 74 other species

    1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR81
    2. Saccharomyces cerevisiae EC1118 SNR81
    3. Saccharomyces cerevisiae Kyokai no. 7 K7_snR81
    4. Saccharomyces cerevisiae P283 SNR81
    5. Saccharomyces cerevisiae P301 SNR81
    6. Saccharomyces cerevisiae PE-2 SNR81
    7. Saccharomyces cerevisiae R008 SNR81
    8. Saccharomyces cerevisiae R103 SNR81
    9. Saccharomyces cerevisiae YJM1078 SNR81
    10. Saccharomyces cerevisiae YJM1083 SNR81
    11. Saccharomyces cerevisiae YJM1129 SNR81
    12. Saccharomyces cerevisiae YJM1190 SNR81
    13. Saccharomyces cerevisiae YJM1199 SNR81
    14. Saccharomyces cerevisiae YJM1202 SNR81
    15. Saccharomyces cerevisiae YJM1242 SNR81
    16. Saccharomyces cerevisiae YJM1244 SNR81
    17. Saccharomyces cerevisiae YJM1248 SNR81
    18. Saccharomyces cerevisiae YJM1250 SNR81
    19. Saccharomyces cerevisiae YJM1252 SNR81
    20. Saccharomyces cerevisiae YJM1273 SNR81
    21. Saccharomyces cerevisiae YJM1304 SNR81
    22. Saccharomyces cerevisiae YJM1307 SNR81
    23. Saccharomyces cerevisiae YJM1311 SNR81
    24. Saccharomyces cerevisiae YJM1326 SNR81
    25. Saccharomyces cerevisiae YJM1336 SNR81
    26. Saccharomyces cerevisiae YJM1356 SNR81
    27. Saccharomyces cerevisiae YJM1381 SNR81
    28. Saccharomyces cerevisiae YJM1383 SNR81
    29. Saccharomyces cerevisiae YJM1385 SNR81
    30. Saccharomyces cerevisiae YJM1386 SNR81
    31. Saccharomyces cerevisiae YJM1387 SNR81
    32. Saccharomyces cerevisiae YJM1388 SNR81
    33. Saccharomyces cerevisiae YJM1389 SNR81
    34. Saccharomyces cerevisiae YJM1401 SNR81
    35. Saccharomyces cerevisiae YJM1415 SNR81
    36. Saccharomyces cerevisiae YJM1417 SNR81
    37. Saccharomyces cerevisiae YJM1433 SNR81
    38. Saccharomyces cerevisiae YJM1434 SNR81
    39. Saccharomyces cerevisiae YJM1439 SNR81
    40. Saccharomyces cerevisiae YJM1450 SNR81
    41. Saccharomyces cerevisiae YJM1460 SNR81
    42. Saccharomyces cerevisiae YJM1463 SNR81
    43. Saccharomyces cerevisiae YJM1477 SNR81
    44. Saccharomyces cerevisiae YJM1478 SNR81
    45. Saccharomyces cerevisiae YJM1526 SNR81
    46. Saccharomyces cerevisiae YJM1527 SNR81
    47. Saccharomyces cerevisiae YJM1574 SNR81
    48. Saccharomyces cerevisiae YJM1592 SNR81
    49. Saccharomyces cerevisiae YJM1615 SNR81
    50. Saccharomyces cerevisiae YJM189 SNR81
    51. Saccharomyces cerevisiae YJM193 SNR81
    52. Saccharomyces cerevisiae YJM195 SNR81
    53. Saccharomyces cerevisiae YJM244 SNR81
    54. Saccharomyces cerevisiae YJM248 SNR81
    55. Saccharomyces cerevisiae YJM270 SNR81
    56. Saccharomyces cerevisiae YJM271 SNR81
    57. Saccharomyces cerevisiae YJM320 SNR81
    58. Saccharomyces cerevisiae YJM326 SNR81
    59. Saccharomyces cerevisiae YJM428 SNR81
    60. Saccharomyces cerevisiae YJM451 SNR81
    61. Saccharomyces cerevisiae YJM453 SNR81
    62. Saccharomyces cerevisiae YJM470 SNR81
    63. Saccharomyces cerevisiae YJM541 SNR81
    64. Saccharomyces cerevisiae YJM554 SNR81
    65. Saccharomyces cerevisiae YJM555 SNR81
    66. Saccharomyces cerevisiae YJM627 SNR81
    67. Saccharomyces cerevisiae YJM681 SNR81
    68. Saccharomyces cerevisiae YJM682 SNR81
    69. Saccharomyces cerevisiae YJM689 SNR81
    70. Saccharomyces cerevisiae YJM693 SNR81
    71. Saccharomyces cerevisiae YJM969 SNR81
    72. Saccharomyces cerevisiae YJM972 SNR81
    73. Saccharomyces cerevisiae YJM987 SNR81
    74. Saccharomyces cerevisiae YJM993 SNR81
    2D structure New