Caution, this is an AI generated summary based on literature. This may have errors, see here for more.
Please share your feedback with us.
hsa-mir-492: Hsa-mir-492 is a microRNA that is part of a miRNA-hub gene regulatory network in PE STB-EVs [PMC9646584]. It is one of several miRNAs, including hsa-miR-26b-5p, hsa-miR-192-5p, hsa-miR-124-3p, hsa-mir-492, hsa-miR-34a-5p, and hsa-miR-155-5p, that have higher amounts of cross-linked genes [PMC9646584]. Hsa-mir-492 has a mature miRNA sequence of AGGACCUGCGGGACAAGAUUCUU [PMC9646584]. It has been validated using RT-qPCR with primers and probes from the TaqMan® microRNA Assays Kit [PMC9768134]. Hsa-mir-492 has been identified in multiple prediction methods and is one of five miRNAs that overlap in all the methods chosen [PMC8349354]. It shows consistently higher expression across all ER-positive cell lines and has been implicated in breast carcinogenesis as well as brain tumors [PMC3672661]. Hsa-mir-492 has also been linked to hepatic cancer [PMC3672661]. In a cohort study involving OSAHS patients and controls, hsa-mir-492 was one of four upregulated miRNAs that were validated by qRT-qPCR [PMC6753562]. Hsa-mir 492 has also been associated with specific target genes such as MAP3K8, TMEM178, and PSME4 [PMC4018277].
mRNA interactions
8 total
Genome locations
Gene Ontology annotations
Ancestor Chart
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset