hsa-mir-492: Hsa-mir-492 is a microRNA that is part of a miRNA-hub gene regulatory network in PE STB-EVs [PMC9646584]. It is one of several miRNAs, including hsa-miR-26b-5p, hsa-miR-192-5p, hsa-miR-124-3p, hsa-mir-492, hsa-miR-34a-5p, and hsa-miR-155-5p, that have higher amounts of cross-linked genes [PMC9646584]. Hsa-mir-492 has a mature miRNA sequence of AGGACCUGCGGGACAAGAUUCUU [PMC9646584]. It has been validated using RT-qPCR with primers and probes from the TaqMan® microRNA Assays Kit [PMC9768134]. Hsa-mir-492 has been identified in multiple prediction methods and is one of five miRNAs that overlap in all the methods chosen [PMC8349354]. It shows consistently higher expression across all ER-positive cell lines and has been implicated in breast carcinogenesis as well as brain tumors [PMC3672661]. Hsa-mir-492 has also been linked to hepatic cancer [PMC3672661]. In a cohort study involving OSAHS patients and controls, hsa-mir-492 was one of four upregulated miRNAs that were validated by qRT-qPCR [PMC6753562]. Hsa-mir 492 has also been associated with specific target genes such as MAP3K8, TMEM178, and PSME4 [PMC4018277].