Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cochliomyia macellaria (secondary screw-worm) mature cma-miR-927-5p URS000031F343_66361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUAGAAUUCCUACGCUUUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Acyrthosiphon pisum api-miR-927
  2. Aedes aegypti Aae-Mir-927-P1_5p (mature (guide))
  3. Anopheles gambiae (African malaria mosquito) aga-miR-927
  4. Blattella germanica Bge-Mir-927-P1_5p (mature (guide))
  5. Bombyx mori bmo-miR-927-5p
  6. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-927-5p
  7. Dinoponera quadriceps dqu-miR-927a-5p
  8. Drosophila ananassae Dan-Mir-927-P1_5p (mature (co-guide))
  9. Drosophila melanogaster dme-miR-927-5p
  10. Drosophila mojavensis Dmo-Mir-927-P1_5p (mature (guide))
  11. Drosophila pseudoobscura dps-miR-927-5p
  12. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0330889_df_nrg
  13. Drosophila simulans dsi-miR-927-5p
  14. Drosophila virilis dvi-miR-927-5p
  15. Drosophila yakuba Dya-Mir-927-P1_5p (mature (guide))
  16. Heliconius melpomene (postman butterfly) hme-miR-927
  17. Polistes canadensis pca-miR-927a-5p
  18. Tribolium castaneum (red flour beetle) Tca-Mir-927-P1_5p (mature (guide))