v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila guanche tRNA.Met secondary structure diagram

Drosophila guanche tRNA.Met URS000031BBD5_7266

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCUCGAUGGCGCAGUUGGCAGCGCGUAAGUCUCAUAAUCUUAAGGUCGUGAGUUCGAGCCUCACUCGGGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Culex quinquefasciatus tRNA tRNA-Met
  2. Drosophila erecta tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  3. Drosophila ficusphila tRNA
  4. Drosophila gunungcola tRNA-OTHER
  5. Drosophila melanogaster transfer RNA:Methionine-CAT 2-1 (Dmel_CR32273)
  6. Drosophila persimilis tRNA-Met (CAT) (tRNA-Met-CAT-3-1)
  7. Drosophila pseudoobscura pseudoobscura tRNA-Met (CAT) (tRNA-Met-CAT-3-1)
  8. Drosophila sechellia tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  9. Drosophila simulans tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  10. Drosophila yakuba tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
 2D structure