Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Glycine tRNA (tRNA-Gly), predicted by tRNAscan-SE analysis secondary structure diagram

Saccharomyces cerevisiae S288C Glycine tRNA (tRNA-Gly), predicted by tRNAscan-SE analysis URS000031B782_559292

Automated summary: This tRNA sequence is 71 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (GtRNAdb, ENA, Rfam, SGD, IntAct). Described in 59 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C Glycine tRNA (tRNA-Gly), predicted by tRNAscan-SE analysis sequence is a product of tRNA-Gly-GCC-1-11, tRNA-Gly-GCC-1-16, tRNA-Gly-GCC-1-3, tRNA-Gly-GCC-1-13, tRNA-Gly-GCC-1-7, SUF16, SUF20, tRNA-Gly-GCC-1-15, tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-9, tRNA-Gly-GCC-1-5, tRNA-Gly-GCC-1-12, tRNA-Gly-GCC-1-8, tRNA-Gly-GCC-1-2, tRNA-Gly-GCC-1-4, tRNA-Gly-GCC-1-10, tRNA-Gly-GCC-1-6, SUF23, SUF17, tRNA-Gly-GCC-1-14 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 8

According to IntAct, Saccharomyces cerevisiae S288C Glycine tRNA (tRNA-Gly), predicted by tRNAscan-SE analysis interacts with:

Interaction id Participant Synonyms
EBI-12520601 Q12383 D6W1U3 EBI-32166 Q12383 TRM13 YOL125W tRNA methylase 13 trm13_yeast
EBI-12513693 Q12383 D6W1U3 EBI-32166 Q12383 TRM13 YOL125W tRNA methylase 13 trm13_yeast
EBI-12515855 Q12383 D6W1U3 EBI-32166 Q12383 TRM13 YOL125W tRNA methylase 13 trm13_yeast
EBI-12515966 Q12383 D6W1U3 EBI-32166 Q12383 TRM13 YOL125W tRNA methylase 13 trm13_yeast
EBI-11701134 Q12400 D6W1X5 EBI-29692 O0926 Q12400 TRM10 YOL093W tRNA methyltransferase 10 tRNA(m1G9)-methyltransferase trm10_yeast
EBI-11701287 Q12400 D6W1X5 EBI-29692 O0926 Q12400 TRM10 YOL093W tRNA methyltransferase 10 tRNA(m1G9)-methyltransferase trm10_yeast
EBI-11701313 Q12400 D6W1X5 EBI-29692 O0926 Q12400 TRM10 YOL093W tRNA methyltransferase 10 tRNA(m1G9)-methyltransferase trm10_yeast
EBI-11701256 Q8TBZ6 B2R8X7 EBI-11059925 Q8TBZ6 Q9Y2T9 RG9MTD2 RNA (guanine-9-)-methyltransferase domain-containing protein 2 TRMT10A tRNA (guanine(9)-N(1))-methyltransferase TRMT10A tm10a_human

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCGCAAGUGGUUUAGUGGUAAAAUCCAACGUUGCCAUCGUUGGGCCCCCGGUUCGAUUCCGGGCUUGCGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 185 other species

    1. [Candida] auris tRNA
    2. [Candida] duobushaemulonis tRNA-Gly
    3. [Candida] glabrata CBS 138 tRNA
    4. [Candida] glabrata tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 11)
    5. [Candida] haemuloni s tRNA-Gly
    6. [Candida] intermedia tRNA
    7. [Candida] pseudohaemulonii tRNA-Gly
    8. Clavispora lusitaniae ATCC 42720 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 12)
    9. Clavispora lusitaniae tRNA-Gly
    10. Drosophila simulans tRNA-Gly
    11. Eremothecium cymbalariae DBVPG#7215 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 7)
    12. Eremothecium sinecaudum tRNA-Gly
    13. Hyphopichia burtonii NRRL Y-1933 tRNA
    14. Kazachstania africana CBS 2517 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 17)
    15. Kazachstania barnettii transfer RNA-Gly(GCC)
    16. Kazachstania naganishii CBS 8797 tRNA-Gly (GCC) (tRNA-Gly-GCC-2 1 to 8)
    17. Kazachstania saulgeensis tRNA
    18. Kazachstania servazzii partial transfer RNA
    19. Lachancea dasiensis tRNA
    20. Lachancea dasiensis tRNA-Gly (GCC) cove score=62.73
    21. Lachancea kluyveri NRRL Y-12651 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
    22. Lachancea kluyveri partial transfer RNA
    23. Lachancea lanzarotensis tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
    24. Lachancea meyersii CBS 8951 tRNA-Gly (GCC) cove score=62.73
    25. Lachancea nothofagi CBS 11611 tRNA
    26. Lachancea sp. CBS 6924 tRNA-Gly (GCC) cove score=62.73
    27. Metschnikowia aff. pulcherrima tRNA-Gly
    28. Metschnikowia bicuspidata var. bicuspidata NRRL YB-4993 tRNA
    29. Pseudomonas savastanoi pv. glycinea tRNA-Gly
    30. Pseudomonas syringae pv. pisi tRNA-Gly
    31. Rothia sp. Olga tRNA-Gly
    32. Saccharomyces arboricola H-6 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    33. Saccharomyces boulardii (nom. inval.) tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 17)
    34. Saccharomyces cerevisiae AWRI796 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
    35. Saccharomyces cerevisiae (baker's yeast) tRNA-Gly, anticodon gcc, length = 71
    36. Saccharomyces cerevisiae CBS 7960 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    37. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    38. Saccharomyces cerevisiae CLIB215 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    39. Saccharomyces cerevisiae CLIB324 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
    40. Saccharomyces cerevisiae CLIB382 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 8)
    41. Saccharomyces cerevisiae EC1118 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    42. Saccharomyces cerevisiae EC9-8 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
    43. Saccharomyces cerevisiae FL100 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
    44. Saccharomyces cerevisiae FostersB tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 10)
    45. Saccharomyces cerevisiae FostersO tRNA
    46. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
    47. Saccharomyces cerevisiae Lalvin QA23 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 12)
    48. Saccharomyces cerevisiae P283 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
    49. Saccharomyces cerevisiae P301 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 12)
    50. Saccharomyces cerevisiae PE-2 tRNA-Gly
    51. Saccharomyces cerevisiae PW5 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 12)
    52. Saccharomyces cerevisiae R008 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    53. Saccharomyces cerevisiae R103 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
    54. Saccharomyces cerevisiae RM11-1a tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    55. Saccharomyces cerevisiae Sigma1278b tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    56. Saccharomyces cerevisiae T73 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    57. Saccharomyces cerevisiae T7 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    58. Saccharomyces cerevisiae UC5 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
    59. Saccharomyces cerevisiae UFMG A-905 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 17)
    60. Saccharomyces cerevisiae Vin13 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 15)
    61. Saccharomyces cerevisiae VL3 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 11)
    62. Saccharomyces cerevisiae W303 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    63. Saccharomyces cerevisiae Y10 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 11)
    64. Saccharomyces cerevisiae YJM1078 tRNA-Gly
    65. Saccharomyces cerevisiae YJM1083 tRNA-Gly
    66. Saccharomyces cerevisiae YJM1129 tRNA-Gly
    67. Saccharomyces cerevisiae YJM1133 tRNA-Gly
    68. Saccharomyces cerevisiae YJM1190 partial tRNA-Gly
    69. Saccharomyces cerevisiae YJM1199 tRNA-Gly
    70. Saccharomyces cerevisiae YJM1202 tRNA-Gly
    71. Saccharomyces cerevisiae YJM1208 tRNA-Gly
    72. Saccharomyces cerevisiae YJM1242 tRNA-Gly
    73. Saccharomyces cerevisiae YJM1244 tRNA-Gly
    74. Saccharomyces cerevisiae YJM1248 tRNA-Gly
    75. Saccharomyces cerevisiae YJM1250 tRNA-Gly
    76. Saccharomyces cerevisiae YJM1252 tRNA-Gly
    77. Saccharomyces cerevisiae YJM1273 tRNA-Gly
    78. Saccharomyces cerevisiae YJM1304 tRNA-Gly
    79. Saccharomyces cerevisiae YJM1307 tRNA-Gly
    80. Saccharomyces cerevisiae YJM1311 tRNA-Gly
    81. Saccharomyces cerevisiae YJM1326 tRNA-Gly
    82. Saccharomyces cerevisiae YJM1332 tRNA-Gly
    83. Saccharomyces cerevisiae YJM1336 tRNA-Gly
    84. Saccharomyces cerevisiae YJM1338 tRNA-Gly
    85. Saccharomyces cerevisiae YJM1341 tRNA-Gly
    86. Saccharomyces cerevisiae YJM1342 tRNA-Gly
    87. Saccharomyces cerevisiae YJM1355 tRNA-Gly
    88. Saccharomyces cerevisiae YJM1356 tRNA-Gly
    89. Saccharomyces cerevisiae YJM1381 tRNA-Gly
    90. Saccharomyces cerevisiae YJM1383 tRNA-Gly
    91. Saccharomyces cerevisiae YJM1385 tRNA-Gly
    92. Saccharomyces cerevisiae YJM1386 tRNA-Gly
    93. Saccharomyces cerevisiae YJM1387 tRNA-Gly
    94. Saccharomyces cerevisiae YJM1388 tRNA-Gly
    95. Saccharomyces cerevisiae YJM1389 tRNA-Gly
    96. Saccharomyces cerevisiae YJM1399 tRNA-Gly
    97. Saccharomyces cerevisiae YJM1400 tRNA-Gly
    98. Saccharomyces cerevisiae YJM1401 tRNA-Gly
    99. Saccharomyces cerevisiae YJM1402 tRNA-Gly
    100. Saccharomyces cerevisiae YJM1415 tRNA-Gly
    101. Saccharomyces cerevisiae YJM1417 tRNA-Gly
    102. Saccharomyces cerevisiae YJM1418 tRNA-Gly
    103. Saccharomyces cerevisiae YJM1419 tRNA-Gly
    104. Saccharomyces cerevisiae YJM1433 tRNA-Gly
    105. Saccharomyces cerevisiae YJM1434 tRNA-Gly
    106. Saccharomyces cerevisiae YJM1439 tRNA-Gly
    107. Saccharomyces cerevisiae YJM1443 tRNA-Gly
    108. Saccharomyces cerevisiae YJM1444 tRNA-Gly
    109. Saccharomyces cerevisiae YJM1447 tRNA-Gly
    110. Saccharomyces cerevisiae YJM1450 tRNA-Gly
    111. Saccharomyces cerevisiae YJM1460 tRNA-Gly
    112. Saccharomyces cerevisiae YJM1463 tRNA-Gly
    113. Saccharomyces cerevisiae YJM1477 tRNA-Gly
    114. Saccharomyces cerevisiae YJM1478 tRNA-Gly
    115. Saccharomyces cerevisiae YJM1479 tRNA-Gly
    116. Saccharomyces cerevisiae YJM1526 tRNA-Gly
    117. Saccharomyces cerevisiae YJM1527 tRNA-Gly
    118. Saccharomyces cerevisiae YJM1549 tRNA-Gly
    119. Saccharomyces cerevisiae YJM1573 tRNA-Gly
    120. Saccharomyces cerevisiae YJM1574 tRNA-Gly
    121. Saccharomyces cerevisiae YJM1592 tRNA-Gly
    122. Saccharomyces cerevisiae YJM1615 tRNA-Gly
    123. Saccharomyces cerevisiae YJM189 tRNA-Gly
    124. Saccharomyces cerevisiae YJM193 tRNA-Gly
    125. Saccharomyces cerevisiae YJM195 tRNA-Gly
    126. Saccharomyces cerevisiae YJM244 tRNA-Gly
    127. Saccharomyces cerevisiae YJM248 tRNA-Gly
    128. Saccharomyces cerevisiae YJM269 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    129. Saccharomyces cerevisiae YJM270 tRNA-Gly
    130. Saccharomyces cerevisiae YJM271 tRNA-Gly
    131. Saccharomyces cerevisiae YJM320 tRNA-Gly
    132. Saccharomyces cerevisiae YJM326 tRNA-Gly
    133. Saccharomyces cerevisiae YJM428 tRNA-Gly
    134. Saccharomyces cerevisiae YJM450 tRNA-Gly
    135. Saccharomyces cerevisiae YJM451 tRNA-Gly
    136. Saccharomyces cerevisiae YJM453 tRNA-Gly
    137. Saccharomyces cerevisiae YJM456 tRNA-Gly
    138. Saccharomyces cerevisiae YJM470 tRNA-Gly
    139. Saccharomyces cerevisiae YJM541 tRNA-Gly
    140. Saccharomyces cerevisiae YJM554 tRNA-Gly
    141. Saccharomyces cerevisiae YJM555 tRNA-Gly
    142. Saccharomyces cerevisiae YJM627 tRNA-Gly
    143. Saccharomyces cerevisiae YJM681 tRNA-Gly
    144. Saccharomyces cerevisiae YJM682 tRNA-Gly
    145. Saccharomyces cerevisiae YJM683 tRNA-Gly
    146. Saccharomyces cerevisiae YJM689 tRNA-Gly
    147. Saccharomyces cerevisiae YJM693 tRNA-Gly
    148. Saccharomyces cerevisiae YJM969 tRNA-Gly
    149. Saccharomyces cerevisiae YJM972 tRNA-Gly
    150. Saccharomyces cerevisiae YJM975 tRNA-Gly
    151. Saccharomyces cerevisiae YJM978 tRNA-Gly
    152. Saccharomyces cerevisiae YJM981 tRNA-Gly
    153. Saccharomyces cerevisiae YJM984 tRNA-Gly
    154. Saccharomyces cerevisiae YJM987 tRNA-Gly
    155. Saccharomyces cerevisiae YJM990 tRNA-Gly
    156. Saccharomyces cerevisiae YJM993 tRNA-Gly
    157. Saccharomyces cerevisiae YJM996 tRNA-Gly
    158. Saccharomyces cerevisiae YJSH1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    159. Saccharomyces eubayanus tRNA-Gly
    160. Saccharomyces kudriavzevii IFO 1802 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 16)
    161. Saccharomyces pastorianus tRNA-Gly
    162. Tetrapisispora blattae CBS 6284 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 23)
    163. Tetrapisispora phaffii CBS 4417 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 13)
    164. Torulaspora delbrueckii CBS 1146 tRNA
    165. Torulaspora delbrueckii tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 11)
    166. Torulaspora globosa tRNA-Gly
    167. Torulaspora sp. CBS 2947 tRNA-Gly
    168. Vanderwaltozyma polyspora DSM 70294 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 14)
    169. Xanthomonas citri pv. citri tRNA-Gly
    170. Zygotorulaspora mrakii tRNA-Gly
    2D structure New