Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Geobacillus sp. 46C-IIa tRNA-Arg secondary structure diagram

Geobacillus sp. 46C-IIa tRNA-Arg URS0000316653_1963025

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGCUCGUAGCUCAAUUGGAUAGAGCAUCUGACUACGGAUCAGAAGGUUAGGGGUUCGAAUCCUCUCGAGCGCGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 99 other species

  1. Anoxybacteroides amylolyticum tRNA-Arg
  2. [Anoxybacillus] calidus tRNA-Arg
  3. Anoxybacteroides rupiense Anoxybacillus geothermalis tRNA-Arg
  4. Anoxybacillus sp. B2M1 tRNA-Arg
  5. Anoxybacillus sp. B7M1 tRNA-Arg
  6. Anoxybacillus sp. J5B_2022 tRNA-Arg
  7. Anoxybacillus sp. P3H1B tRNA-Arg
  8. Anoxybacillus sp. PDR2 tRNA-Arg
  9. Anoxybacillus sp. tRNA-Arg
  10. Anoxybacillus sp. UARK-01 tRNA-Arg
  11. Anoxybacteroides voinovskiense tRNA-Arg
  12. Anoxybacteroides rupiense tRNA-Arg
  13. Anoxybacteroides tepidamans tRNA-Arg
  14. [Bacillus] caldolyticus tRNA-Arg
  15. Caldibacillus thermoamylovorans tRNA-Arg
  16. [Flavobacterium] thermophilum tRNA-Arg(acg)
  17. Parageobacillus galactosidasius tRNA-Arg
  18. Geobacillus genomosp. 3 tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  19. Geobacillus icigianus tRNA-Arg
  20. Geobacillus jurassicus tRNA-Arg
  21. Geobacillus kaustophilus GBlys tRNA-Arg
  22. Geobacillus kaustophilus HTA426 tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  23. Geobacillus kaustophilus NBRC 102445 tRNA-Arg
  24. Geobacillus kaustophilus tRNA-Arg
  25. Geobacillus lituanicus tRNA-Arg
  26. Geobacillus proteiniphilus tRNA-Arg
  27. Geobacillus sp. 12AMOR1 tRNA-Arg
  28. Geobacillus sp. 44B tRNA-Arg
  29. Geobacillus sp. 44C tRNA-Arg
  30. Geobacillus sp. 47C-IIb tRNA-Arg
  31. Geobacillus sp. A8 tRNA-Arg
  32. Geobacillus sp. BCO2 tRNA-Arg
  33. Geobacillus sp. BK01 tRNA-Arg
  34. Geobacillus sp. BMUD tRNA-Arg
  35. Geobacillus sp. C56-T2 tRNA-Arg
  36. Geobacillus sp. C56-T3 tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  37. Geobacillus sp. CAMR12739 tRNA-Arg
  38. Geobacillus sp. CAMR5420 tRNA-Arg
  39. Geobacillus sp. DSP4a tRNA-Arg
  40. Geobacillus sp. FSL K6-0789 tRNA-Arg
  41. Geobacillus sp. FSL K6-3411 tRNA-Arg
  42. Geobacillus sp. FSL W8-0026 tRNA-Arg
  43. Geobacillus sp. FSL W8-0032 tRNA-Arg
  44. Geobacillus sp. FSL W8-0466 tRNA-Arg
  45. Geobacillus sp. FSL W8-1251 tRNA-Arg
  46. Geobacillus sp. G4 tRNA-Arg
  47. Geobacillus sp. GHH01 tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  48. Geobacillus sp. JS12 tRNA-Arg
  49. Geobacillus sp. LC300 tRNA-Arg
  50. Geobacillus sp. LEMMJ02 tRNA-Arg
  51. Geobacillus sp. LEMMY01 tRNA-Arg
  52. Geobacillus sp. LYN3 tRNA-Arg
  53. Geobacillus sp. Manikaran-105 tRNA-Arg
  54. Geobacillus sp. MMMUD3 tRNA-Arg
  55. Geobacillus sp. MR tRNA-Arg
  56. Geobacillus sp. NFOSA3 tRNA-Arg
  57. Geobacillus sp. PK12 tRNA-Arg
  58. Geobacillus sp. PLS 41 tRNA-Arg
  59. Geobacillus sp. Sah69 tRNA-Arg
  60. Geobacillus sp. T6 tRNA-Arg
  61. Geobacillus sp. TFV-3 tRNA-Arg
  62. Geobacillus sp. WCH70 tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-1-2)
  63. Geobacillus sp. WSUCF-018B tRNA-Arg
  64. Geobacillus sp. WSUCF1 tRNA-Arg
  65. Geobacillus sp. Y412MC52 tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  66. Geobacillus sp. Y412MC61 tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  67. Geobacillus sp. Y4.1MC1 tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  68. Geobacillus sp. YF-1 tRNA-Arg
  69. Geobacillus sp. YHL tRNA-Arg
  70. Geobacillus stearothermophilus ATCC 12980 tRNA-Arg
  71. Geobacillus stearothermophilus ATCC 7953 tRNA-Arg
  72. Geobacillus subterraneus tRNA-Arg
  73. Geobacillus thermocatenulatus tRNA-Arg
  74. Geobacillus thermodenitrificans NG80-2 tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  75. Geobacillus thermodenitrificans tRNA-Arg
  76. Geobacillus thermoleovorans B23 tRNA-Arg
  77. Geobacillus thermoleovorans CCB_US3_UF5 tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  78. Geobacillus thermoleovorans tRNA-Arg
  79. Geobacillus thermopakistaniensis tRNA-Arg
  80. Geobacillus uzenensis tRNA-Arg
  81. Geobacillus vulcani tRNA-Arg
  82. Parageobacillus yumthangensis tRNA-Arg
  83. Geobacillus zalihae tRNA-Arg
  84. Parageobacillus caldoxylosilyticus NBRC 107762 tRNA-Arg
  85. Parageobacillus caldoxylosilyticus tRNA-Arg
  86. Parageobacillus genomosp. 1 tRNA-Arg
  87. Parageobacillus sp. G301 tRNA-Arg
  88. Parageobacillus sp. VR-IP tRNA-Arg
  89. Parageobacillus thermoglucosidasius C56-YS93 tRNA-Arg (ACG) (tRNA-Arg-ACG-1-1)
  90. Parageobacillus thermoglucosidasius NBRC 107763 tRNA-Arg
  91. Parageobacillus thermoglucosidasius TNO-09.020 tRNA-Arg
  92. Parageobacillus thermoglucosidasius tRNA-Arg
  93. Parageobacillus toebii NBRC 107807 tRNA-Arg
  94. Parageobacillus toebii tRNA-Arg
  95. Priestia megaterium tRNA-Arg
  96. Saccharococcus sp. 23_S122 tRNA-Arg
  97. Saccharococcus thermophilus tRNA-Arg
  98. Thermaerobacillus caldiproteolyticus tRNA-Arg
  99. Geobacillus stearothermophilus 10 tRNA-Arg from Geobacillus stearothermophilus 10 (PDB 5B63, chain D)
  100. Geobacillus stearothermophilus tRNA from Geobacillus stearothermophilus (PDB 5YYN, chain D)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...