Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anopheles merus (Mosquito) tRNA tRNA-Pro secondary structure diagram

Anopheles merus (Mosquito) tRNA tRNA-Pro URS0000311140_30066

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUCGUUGGUCUAGGGGUAUGAUUUUCGCUUCGGGUGCGAGAGGUCCCGGGUUCAAUUCCCGGACGAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Aedes aegypti (yellow fever mosquito) partial tRNA-OTHER
  2. Anopheles arabiensis tRNA tRNA-Pro
  3. Anopheles christyi tRNA tRNA-Pro
  4. Anopheles coluzzii tRNA-Pro for anticodon CGG
  5. Anopheles dirus tRNA
  6. Anopheles epiroticus (Mosquito) tRNA tRNA-Pro
  7. Anopheles farauti (Mosquito) tRNA tRNA-Pro
  8. Anopheles funestus tRNA-Pro for anticodon CGG
  9. Anopheles gambiae tRNA tRNA-Pro
  10. Anopheles gambiae str. PEST tRNA-Pro (CGG) (tRNA-Pro-CGG-4-1)
  11. Anopheles maculatus tRNA tRNA-Pro
  12. Anopheles melas (Mosquito) tRNA tRNA-Pro
  13. Anopheles minimus tRNA tRNA-Pro
  14. Anopheles quadriannulatus tRNA tRNA-Pro
  15. Culex pipiens pallens (Northern house mosquito) transfer RNA proline (anticodon CGG)
  16. Culex quinquefasciatus (southern house mosquito) tRNA
  17. Drosophila mauritiana (Fruit fly) tRNA-Pro
  18. Drosophila melanogaster transfer RNA:Proline-CGG 3-1 (Dmel_CR32784)
  19. Drosophila simulans tRNA-Pro (CGG) (tRNA-Pro-CGG-3-1)
  20. Musca domestica (House fly) transfer RNA proline (anticodon CGG)
  21. Stomoxys calcitrans (stable fly) transfer RNA proline (anticodon CGG)
  22. Topomyia yanbarensis (Mosquitos) transfer RNA proline (anticodon CGG)
  23. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA proline (anticodon CGG)
  24. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA proline (anticodon CGG)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications