v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila erecta tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2) secondary structure diagram

Drosophila erecta tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2) URS000030B7E5_7220

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGGAUGUAGCUCAGUGGUAGAGCGCUCGCUUUGCAUGUGAGAGGCCCCGGGUUCAAUCCCCGGCAUCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Ceratitis capitata (Mediterranean fruit fly) tRNA-Ala
  2. Drosophila ananassae tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  3. Drosophila busckii tRNA
  4. Drosophila ficusphila tRNA
  5. Drosophila grimshawi tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  6. Drosophila guanche tRNA.Ala
  7. Drosophila gunungcola tRNA-OTHER
  8. Drosophila melanogaster transfer RNA:Alanine-TGC 2-1 (Dmel_CR30233)
  9. Drosophila mojavensis tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 3)
  10. Drosophila persimilis tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  11. Drosophila pseudoobscura pseudoobscura tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  12. Drosophila sechellia tRNA-Ala (TGC) (tRNA-Ala-TGC-2-1)
  13. Drosophila simulans tRNA-Ala (TGC) (tRNA-Ala-TGC-2-1)
  14. Drosophila virilis tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  15. Drosophila willistoni tRNA-Ala (TGC) (tRNA-Ala-TGC-1 1 to 4)
  16. Drosophila yakuba tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1, tRNA-Ala-TGC-1-2)
  17. Lucilia cuprina tRNA-Ala for anticodon UGC
  18. Musca domestica tRNA MDOA006925
  19. Mya arenaria (Soft-shell clam) transfer RNA alanine (anticodon UGC)
  20. Priapulus caudatus (Penis worm) tRNA-Ala
  21. Stomoxys calcitrans tRNA-Ala
 2D structure