Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3148 URS0000308E4D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3148: Hsa-mir-3148 is a microRNA that has been identified as one of the 16 markers in a study [PMC4076980]. It has been found to target genes such as PRKCA and AR, which are enriched in pathways related to cancer, glioma, and the ErbB signaling pathway [PMC5585581]. The expression of hsa-mir-3148 has been found to be significantly lower in samples of chronic thromboembolic pulmonary hypertension (CTEPH) compared to control samples [PMC5585581]. Hsa-mir-3148 has also been identified as one of the miRNAs that target genes such as CYP1A1, CYP1B1, C7, ADCY2, SERPINB5, and ANAPC13 [PMC7473858]. It has binding sites in the NCR2 region of HPV16 isolates and is one of 14 human miRNAs that target this region [PMC3675152]. Hsa-mir-3148 is also associated with TRIM22 rs7113258 A allele and generates putative target sites for miRNAs such as hsa-miR-4495 and hsa-miR-3668 [PMC9412778]. The expression of hsa-mir-3148 is associated with lower overall survival in various human cancer types [PMC7462980]. It has also been detected in pancreatic cancer-related studies along with other miRNAs such as hsa-miR-494-3p and hsa-miR-143-3p [PMC7907650].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAAAAACUGGUGUGUGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications