Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-337-5p URS0000306C70_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-337: Hsa-mir-337 is a human miRNA locus located at chromosome 14q32.2 [PMC3377607]. It has been associated with various cancers, including head and neck squamous cell carcinoma (HNSCC) [PMC5008307]. In HNSCC, a negative correlation between EGR1 and hsa-mir-337 is related to higher survival rates, while a positive correlation is related to poor survival rates [PMC3836703]. Hsa-mir-337 is part of a six microRNA signature (including hsa-let-7c, hsa-miR-125b-2, hsa-miR-129-1, hsa-miR-654, and hsa-miR-99a) that has been validated as an independent predictor for HNSCC patient survival [PMC5008307]. It has also been shown to play a role in reducing gastric cancer cell invasion capacity and has been associated with lymph node metastasis in gastric cancer [PMC5123339]. In bladder cancer (BLCA), a three miRNA signature consisting of hsa-mir-337, hsa-mir-3913-2, and hsa-mir-497 has been identified as an independent predictor for prognosis [PMC5739658]. Furthermore, in prostate cancer and HNSCC patients, hsa-mir 99a and 137 have also been identified as potential prognostic biomarkers [PMC6409312] [PMC9463596]. Overall, the role of hsa-mir 337 in various cancers suggests its potential as a diagnostic tool and therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAACGGCUUCAUACAGGAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications