Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis lyrata (lyrate rockcress) aly-miR166d-3p URS00003065B2_59689

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aly-miR166a-3p: Aly-mir166a-3p is a plant miRNA that shows strong fluid/tissue specificity, as observed in Fig 5 [PMC6021041]. It is involved in the regulation of HD-ZIP transcription factors, such as BraA06g002210.3C, BraA08g002260.3C, and BraA09g034560.3C [PMC10039531]. These transcription factors are targeted and regulated by aly-mir166a-3p, along with other miRNAs such as ath-miR166a-3p, ath-miR166a-3p_1ss21CA, bna-miR166a, bna-miR166f, cas-miR166e, gma-miR166a-3p_R + 1, and mtr-miR166a_R + 1 [PMC10039531]. In experimental evaluation of genes related to apoptosis in broccoletti plants (Brassica oleracea var. italica), the miRNAs bra-miR156g-5p and Myseq-330 (similar to aly-mir166a-3p) were found to be the most corresponding broccoletti miRNAs [PMC7147085]. Aly-mir166a-3p is a member of the MIR166 family and has been identified as one of the most highly upregulated miRNAs [PMC9010791]. In qPCR analysis of known miRNAs in alfalfa roots (Medicago sativa), aly-mir166a-3p was found to be down-regulated along with other miRNAs such as aqc-miR166a and hbr-miR166a [PMC5406866]. These findings highlight the importance of aly-mir166a-3p in plant development and gene regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGACCAGGCUUCAUUCCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Aegilops tauschii ata-miR166d-3p
  2. Amborella trichopoda atr-miR166d
  3. Ananas comosus microRNA 166b
  4. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR166e
  5. Arabidopsis thaliana ath-miR166b-3p
  6. Asparagus officinalis aof-miR166d
  7. Brachypodium distachyon bdi-miR166d-3p
  8. Brassica napus (rape) bna-miR166c
  9. Carica papaya (papaya) cpa-miR166c
  10. Citrus sinensis (sweet orange) csi-miR166e-3p
  11. Cucumis melo cme-miR166d
  12. Cynara cardunculus var. scolymus cca-miR166b
  13. Digitalis purpurea dpr-miR166b
  14. Eugenia uniflora (Brazil-cherry) eun-miR166-3p
  15. Fragaria vesca subsp. vesca fve-miR166e
  16. Glycine max (soybean) gma-miR166b
  17. Gossypium hirsutum ghr-miR166b
  18. Helianthus annuus ath-miR166a-3p
  19. Helianthus paradoxus hpa-miR166a
  20. Helianthus petiolaris hpe-miR166a
  21. Hordeum vulgare (barley) hvu-miR166a
  22. Hypericum perforatum Hyp-miR166
  23. Linum usitatissimum (flax) lus-miR166j
  24. Malus domestica mdm-miR166f
  25. Manihot esculenta mes-miR166d
  26. Medicago truncatula (barrel medic) mtr-miR166g-3p
  27. Musa AAB Group miR166
  28. Mus musculus Mus_musculus piRNA piR-mmu-50191420
  29. Nicotiana attenuata microRNA mir-166-like
  30. Nicotiana tabacum nta-miR166f
  31. Oryza sativa (Asian cultivated rice) osa-miR166d-3p
  32. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR166b-3p
  33. Pachycladon cheesemanii Pch-miR166a
  34. Pachycladon fastigiatum Pfa-miR166a
  35. Phaseolus vulgaris (string bean) pvu-miR166a
  36. Physcomitrium patens ppt-miR166g
  37. Picea abies pab-miR166h
  38. Pinus taeda pta-miR166b
  39. Populus tomentosa Pto-miR166h
  40. Populus trichocarpa (black cottonwood) ptc-miR166g
  41. Prunus persica (peach) ppe-miR166a
  42. Ricinus communis rco-miR166e
  43. Rosa chinensis ath-miR166a-3p
  44. Saccharum sp. ssp-miR166
  45. Salvia sclarea ssl-miR166b
  46. Selaginella moellendorffii smo-miR166c
  47. Solanum lycopersicum (tomato) sly-miR166b
  48. Solanum tuberosum stu-miR166a-3p
  49. Theobroma cacao tcc-miR166a
  50. Vitis vinifera (wine grape) vvi-miR166f
  51. Vriesea carinata vca-miR166c-3p
  52. Zea mays (maize) zma-miR166a-3p
Publications