v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR171h URS000030490C_39947

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGAGCCGAACCAAUAUCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Oryza sativa (Asian cultivated rice) osa-miR171h
  2. Sorghum bicolor sbi-miR171e
  3. Zea mays (maize) zma-miR171k-3p