v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72410 URS00002FDD5B_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAAAGUGCUUACAGUGCAGGUAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Ateles geoffroyi (black-handed spider monkey) age-miR-17-5p
  2. Bos taurus bta-miR-17-5p
  3. Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-425677
  4. Capra hircus (goat) chi-miR-17-5p
  5. Drosophila erecta Drosophila_erecta piRNA piR-der-149061
  6. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-21097546
  7. Gallus gallus gga-miR-17-5p
  8. Gorilla gorilla gorilla ggo-miR-17-5p (MIR17)
  9. Gorilla gorilla (western gorilla) ggo-miR-17-5p
  10. Homo sapiens (human) microRNA miR-91
  11. Lagothrix lagotricha (brown woolly monkey) lla-miR-17-5p
  12. Lemur catta (Ring-tailed lemur) lca-miR-17-5p
  13. Macaca mulatta (Rhesus monkey) mml-miR-17-5p
  14. Macaca nemestrina mne-miR-17-5p
  15. Monodelphis domestica mdo-miR-17-5p
  16. Ophiophagus hannah oha-miR-17-5p
  17. Oryctolagus cuniculus (rabbit) Oryctolagus_cuniculus piRNA piR-ocu-114588
  18. Ovis aries (sheep) miscellaneous RNA
  19. Pan paniscus ppa-miR-17-5p
  20. Pan troglodytes (chimpanzee) ptr-miR-17-5p
  21. Pongo pygmaeus (Bornean orangutan) ppy-miR-17-5p
  22. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62952
  23. Saguinus labiatus sla-miR-17-5p
  24. Xenopus laevis xla-miR-17-5p
  25. Xenopus tropicalis (tropical clawed frog) xtr-miR-17-5p