v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Daphnia pulex (common water flea) Dpu-Mir-96-P3_5p (mature (guide)) URS00002FC254_6669

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUGGCACUGGAAGAAUUCACGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Aedes aegypti (yellow fever mosquito) Aae-Mir-96-P3_5p (mature (guide))
  2. Bactrocera dorsalis bdo-miR-263a
  3. Blattella germanica Bge-Mir-96-P3_5p (mature (guide))
  4. Cochliomyia hominivorax mature cho-miR-263a-5p
  5. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-263a-5p
  6. Daphnia magna Dma-Mir-96-P3_5p (mature (guide))
  7. Dinoponera quadriceps dqu-miR-263a-5p
  8. Drosophila ananassae Dan-Mir-96-P3_5p (mature (guide))
  9. Drosophila erecta Drosophila_erecta piRNA piR-der-40328
  10. Drosophila melanogaster (fruit fly) dme-miR-263a-5p
  11. Drosophila mojavensis Dmo-Mir-96-P3_5p (mature (guide))
  12. Drosophila simulans Dsi-Mir-96-P3_5p (mature (guide))
  13. Drosophila virilis dvi-miR-263a-5p
  14. Drosophila yakuba Dya-Mir-96-P3_5p (mature (guide))
  15. Gallus gallus Gallus_gallus piRNA piR-gga-20390
  16. Heliconius melpomene Hme-Mir-96-P3_5p (mature (guide))
  17. Hyalella azteca miR-263a
  18. Manduca sexta (tobacco hornworm) mse-miR-263a
  19. Oryctolagus cuniculus (rabbit) Oryctolagus_cuniculus piRNA piR-ocu-781725
  20. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-2041525
  21. Tribolium castaneum (red flour beetle) tca-miR-263a-5p
  22. Triops cancriformis tcf-miR-263a