Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Escherichia coli str. K-12 substr. MG1655 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1) secondary structure diagram

Escherichia coli str. K-12 substr. MG1655 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1) URS00002F9CDD_511145

Automated summary: This tRNA sequence is 95 nucleotides long and is found in Escherichia coli str. K-12 substr. MG1655. Annotated by 2 databases (ENA, GtRNAdb). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA-Sec, RF01852). Escherichia coli str. K-12 substr. MG1655 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1) sequence is a product of tRNA-SeC-TCA-1-1, selC genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGAAGAUCGUCGUCUCCGGUGAGGCGGCUGGACUUCAAAUCCAGUUGGGGCCGCCAGCGGUCCCGGGCAGGUUCGACUCCUGUGAUCUUCCGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2,665 other species

    1. Escherichia coli tRNA-seC(tca)
    2. Aerococcus urinaeequi tRNA-Sec
    3. Alistipes onderdonkii tRNA-Sec
    4. bacteria symbiont BFo1 of Frankliniella occidentalis tRNA-Sec
    5. Bacteroides thetaiotaomicron tRNA-Sec
    6. Bifidobacterium adolescentis tRNA-Sec
    7. Bifidobacterium longum tRNA-Sec
    8. Citrobacter amalonaticus tRNA-SeC
    9. Citrobacter amalonaticus Y19 tRNA-Sec
    10. Citrobacter farmeri tRNA-Sec
    11. Citrobacter freundii complex sp. CFNIH2 tRNA-Sec
    12. Citrobacter freundii tRNA-Sec
    13. Citrobacter koseri ATCC BAA-895 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    14. Citrobacter koseri tRNA-SeC
    15. Citrobacter rodentium ICC168 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    16. Citrobacter rodentium tRNA-Sec
    17. Citrobacter sedlakii tRNA-Sec
    18. Citrobacter sp. 50677481 tRNA-Sec
    19. Citrobacter telavivensis tRNA-Sec
    20. Citrobacter sp. RHB20-C15 tRNA-Sec
    21. Citrobacter sp. RHB20-C16 tRNA-Sec
    22. Citrobacter sp. RHB21-C01 tRNA-Sec
    23. Citrobacter sp. RHB21-C05 tRNA-Sec
    24. Citrobacter sp. RHB35-C17 tRNA-Sec
    25. Citrobacter sp. TBCP-5362 tRNA-Sec
    26. Citrobacter sp. Y3 tRNA-Sec
    27. Citrobacter telavivensis tRNA-Sec
    28. Cronobacter condimenti 1330 tRNA-Sec
    29. Cronobacter malonaticus ENBT0334 tRNA-Sec
    30. Cronobacter malonaticus LMG 23826 tRNA-Sec
    31. Cronobacter malonaticus tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    32. Cronobacter sakazakii ATCC BAA-894 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    33. Cronobacter sakazakii ES15 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    34. Cronobacter sakazakii SP291 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    35. Cronobacter sakazakii tRNA-Sec
    36. Cronobacter turicensis tRNA-Sec
    37. Cronobacter turicensis z3032 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    38. Cronobacter universalis NCTC 9529 tRNA-Sec
    39. Cronobacter universalis tRNA-seC(tca)
    40. Edwardsiella hoshinae tRNA-seC(tca)
    41. Edwardsiella tarda ATCC 15947 = NBRC 105688 tRNA-Sec
    42. Edwardsiella tarda tRNA-Sec
    43. Enterobacter hormaechei tRNA-Sec
    44. Enterobacteriaceae bacterium 8376wD7 tRNA-Sec
    45. Enterobacteriaceae bacterium 8376wD8 tRNA-Sec
    46. Enterobacteriaceae bacterium 8376wD9 tRNA-Sec
    47. Enterobacteriaceae bacterium 8376wG6 tRNA-Sec
    48. Enterobacteriaceae bacterium 8376wH8 tRNA-Sec
    49. Enterobacteriaceae bacterium BIT-l23 tRNA-Sec
    50. Enterobacteriaceae bacterium tRNA-Sec
    51. Enterobacteriaceae bacterium TzEc013 tRNA-Sec
    52. Enterobacteriaceae bacterium TzEc051 tRNA-Sec
    53. Enterobacteriaceae bacterium TzEc058 tRNA-Sec
    54. Enterobacteriaceae bacterium TzEc077 tRNA-Sec
    55. Enterobacteriaceae bacterium TzEc084 tRNA-Sec
    56. Enterobacter sp. EC-NT1 tRNA-Sec
    57. Erwinia aphidicola tRNA-Sec
    58. Erwinia persicina tRNA-Sec
    59. Erwinia sp. CPCC 100877 tRNA-Sec
    60. Erwinia sp. J316 tRNA-Sec
    61. Erwinia sp. J780 tRNA-Sec
    62. Erwinia sp. S38 tRNA-Sec
    63. Escherichia alba tRNA-Sec
    64. Escherichia albertii KF1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    65. Escherichia albertii tRNA-Sec
    66. Escherichia albertii TW07627 tRNA-Sec
    67. Escherichia coli 042 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    68. Escherichia coli 101-1 tRNA-Sec
    69. Escherichia coli 1303 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    70. Escherichia coli 53638 tRNA-Sec
    71. Escherichia coli 536 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    72. Escherichia coli 541-15 tRNA-Sec
    73. Escherichia coli 541-1 tRNA-Sec
    74. Escherichia coli 55989 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    75. Escherichia coli 75 tRNA-Sec
    76. Escherichia coli 95JB1 tRNA-Sec
    77. Escherichia coli 95NR1 tRNA-Sec
    78. Escherichia coli ABU 83972 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    79. Escherichia coli APEC O18 tRNA-Sec
    80. Escherichia coli APEC O1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    81. Escherichia coli APEC O2-211 tRNA-Sec
    82. Escherichia coli APEC O2 tRNA-Sec
    83. Escherichia coli APEC O78 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    84. Escherichia coli ATCC 25922 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    85. Escherichia coli ATCC 35150 tRNA-Sec
    86. Escherichia coli ATCC 8739 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    87. Escherichia coli ATCC BAA-2192 tRNA-Sec
    88. Escherichia coli ATCC BAA-2193 tRNA-Sec
    89. Escherichia coli ATCC BAA-2196 tRNA-Sec
    90. Escherichia coli ATCC BAA-2209 tRNA-Sec
    91. Escherichia coli ATCC BAA-2215 tRNA-Sec
    92. Escherichia coli ATCC BAA-2219 tRNA-Sec
    93. Escherichia coli B171 tRNA-Sec
    94. Escherichia coli B7A tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    95. Escherichia coli BL21(DE3) tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    96. Escherichia coli 'BL21-Gold(DE3)pLysS AG' tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    97. Escherichia coli BL21 tRNA-Sec
    98. Escherichia coli B str. REL606 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    99. Escherichia coli B tRNA-Sec
    100. Escherichia coli BW25113 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    101. Escherichia coli BW2952 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    102. Escherichia coli C691-71 (14b) tRNA-Sec
    103. Escherichia coli CFT073 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    104. Escherichia coli C tRNA-Sec
    105. Escherichia coli CUMT8 tRNA-Sec
    106. Escherichia coli DH1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    107. Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 tRNA-Sec
    108. Escherichia coli E1140 tRNA-Sec
    109. Escherichia coli E1728 tRNA-Sec
    110. Escherichia coli E22 tRNA-Sec
    111. Escherichia coli ECA-0157 tRNA-Sec
    112. Escherichia coli ECA-727 tRNA-Sec
    113. Escherichia coli ECC-1470 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    114. Escherichia coli ED1a tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    115. Escherichia coli ER2796 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    116. Escherichia coli ETEC H10407 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    117. Escherichia coli F11 tRNA-Sec
    118. Escherichia coli FAP1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    119. Escherichia coli H19 tRNA-Sec
    120. Escherichia coli H20 tRNA-Sec
    121. Escherichia coli H8 tRNA-Sec
    122. Escherichia coli HM605 tRNA-Sec
    123. Escherichia coli HS tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    124. Escherichia coli HT115 tRNA-Sec
    125. Escherichia coli HVH 101 (4-6859844) tRNA-Sec
    126. Escherichia coli HVH 54 (4-2723514) (4-2723514) tRNA-Sec
    127. Escherichia coli HVH 93 (4-5851025) tRNA-Sec
    128. Escherichia coli IAI1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    129. Escherichia coli IAI39 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    130. Escherichia coli IHE3034 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    131. Escherichia coli J96 tRNA-Sec
    132. Escherichia coli JJ1886 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    133. Escherichia coli JJ1887 tRNA-Sec
    134. Escherichia coli K-12 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    135. Escherichia coli K71 tRNA-Sec
    136. Escherichia coli KLY tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    137. Escherichia coli KO11FL tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    138. Escherichia coli LAU-EC10 tRNA-Sec
    139. Escherichia coli LAU-EC6 tRNA-Sec
    140. Escherichia coli LAU-EC7 tRNA-Sec
    141. Escherichia coli LAU-EC8 tRNA-Sec
    142. Escherichia coli LAU-EC9 tRNA-Sec
    143. Escherichia coli LF82 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    144. Escherichia coli LY180 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    145. Escherichia coli M12 tRNA-Sec
    146. Escherichia coli M4 tRNA-Sec
    147. Escherichia coli M8 tRNA-Sec
    148. Escherichia coli MP1 tRNA-Sec
    149. Escherichia coli MRSN 10204 tRNA-Sec
    150. Escherichia coli N36254PS tRNA-Sec
    151. Escherichia coli N36410PS tRNA-Sec
    152. Escherichia coli N37058PS tRNA-Sec
    153. Escherichia coli N37122PS tRNA-Sec
    154. Escherichia coli N37139PS tRNA-Sec
    155. Escherichia coli N40513 tRNA-Sec
    156. Escherichia coli N40607 tRNA-Sec
    157. Escherichia coli NA114 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    158. Escherichia coli NB8 tRNA-Sec
    159. Escherichia coli NC101 tRNA-Sec
    160. Escherichia coli NCTC 50110 tRNA-Sec
    161. Escherichia coli Nissle 1917 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    162. Escherichia coli NU14 tRNA-Sec
    163. Escherichia coli O100:H21 tRNA-Sec
    164. Escherichia coli O100 tRNA-Sec
    165. Escherichia coli O101 tRNA-Sec
    166. Escherichia coli O102 tRNA-Sec
    167. Escherichia coli O103:H11 str. 04-3023 tRNA-Sec
    168. Escherichia coli O103:H11 str. 2010C-3214 tRNA-Sec
    169. Escherichia coli O103:H25 str. 2010C-4529 tRNA-Sec
    170. Escherichia coli O103:H25 str. CVM9340 tRNA-Sec
    171. Escherichia coli O103:H2 str. 12009 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    172. Escherichia coli O103:H2 str. 2009C-3279 tRNA-Sec
    173. Escherichia coli O103:H2 str. 2010C-4433 tRNA-Sec
    174. Escherichia coli O103:H2 str. 2011C-3750 tRNA-Sec
    175. Escherichia coli O103:H2 str. CVM9450 tRNA-Sec
    176. Escherichia coli O103:H2 tRNA-Sec
    177. Escherichia coli O103 str. RM8385 tRNA-Sec
    178. Escherichia coli O103 tRNA-Sec
    179. Escherichia coli O104:H21 str. 94-3025 tRNA-Sec
    180. Escherichia coli O104:H21 str. CFSAN002236 tRNA-Sec
    181. Escherichia coli O104:H21 str. CFSAN002237 tRNA-Sec
    182. Escherichia coli O104:H4 str. 2009EL-2050 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    183. Escherichia coli O104:H4 str. 2009EL-2071 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    184. Escherichia coli O104:H4 str. 2011C-3493 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    185. Escherichia coli O104:H4 str. 2011EL-1675A tRNA-Sec
    186. Escherichia coli O104:H4 str. C227-11 tRNA-Sec
    187. Escherichia coli O104:H4 tRNA-Sec
    188. Escherichia coli O105 tRNA-Sec
    189. Escherichia coli O106 tRNA-Sec
    190. Escherichia coli O108:H9 tRNA-Sec
    191. Escherichia coli O109 tRNA-Sec
    192. Escherichia coli O10:H32 tRNA-Sec
    193. Escherichia coli O10 tRNA-Sec
    194. Escherichia coli O110 tRNA-Sec
    195. Escherichia coli O111:H8 str. 2009C-4126 tRNA-Sec
    196. Escherichia coli O111:H8 str. 2009EL-2169 tRNA-Sec
    197. Escherichia coli O111:H8 str. 2011C-3453 tRNA-Sec
    198. Escherichia coli O111:H8 str. CFSAN001632 tRNA-Sec
    199. Escherichia coli O111:H8 str. CVM9570 tRNA-Sec
    200. Escherichia coli O111:H8 str. CVM9574 tRNA-Sec
    201. Escherichia coli O111:H8 str. CVM9602 tRNA-Sec
    202. Escherichia coli O111:H8 str. CVM9634 tRNA-Sec
    203. Escherichia coli O111:H8 str. F6627 tRNA-Sec
    204. Escherichia coli O111:H8 tRNA-Sec
    205. Escherichia coli O111:H- str. 11128 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    206. Escherichia coli O111:H- tRNA-Sec
    207. Escherichia coli O111:NM str. 01-3076 tRNA-Sec
    208. Escherichia coli O111:NM str. 03-3484 tRNA-Sec
    209. Escherichia coli O111:NM str. 04-3211 tRNA-Sec
    210. Escherichia coli O111:NM str. 08-4487 tRNA-Sec
    211. Escherichia coli O111:NM str. 2009C-4006 tRNA-Sec
    212. Escherichia coli O111:NM str. 2009C-4052 tRNA-Sec
    213. Escherichia coli O111:NM str. 2010C-3053 tRNA-Sec
    214. Escherichia coli O111:NM str. 2010C-3977 tRNA-Sec
    215. Escherichia coli O111:NM str. 2010C-4086 tRNA-Sec
    216. Escherichia coli O111:NM str. 2010C-4221 tRNA-Sec
    217. Escherichia coli O111:NM str. 2010C-4592 tRNA-Sec
    218. Escherichia coli O111:NM str. 2010C-4622 tRNA-Sec
    219. Escherichia coli O111:NM str. 2010C-4715 tRNA-Sec
    220. Escherichia coli O111:NM str. 2010C-4735 tRNA-Sec
    221. Escherichia coli O111:NM str. 2010C-4746 tRNA-Sec
    222. Escherichia coli O111:NM str. 2010C-4799 tRNA-Sec
    223. Escherichia coli O111:NM str. 2010C-4818 tRNA-Sec
    224. Escherichia coli O111:NM str. 2011C-3170 tRNA-Sec
    225. Escherichia coli O111:NM str. 2011C-3362 tRNA-Sec
    226. Escherichia coli O111:NM str. 2011C-3573 tRNA-Sec
    227. Escherichia coli O111:NM str. 2011C-3632 tRNA-Sec
    228. Escherichia coli O111:NM str. 2011C-3679 tRNA-Sec
    229. Escherichia coli O111:NM str. K6722 tRNA-Sec
    230. Escherichia coli O111:NM str. K6723 tRNA-Sec
    231. Escherichia coli O111:NM str. K6728 tRNA-Sec
    232. Escherichia coli O111:NM str. K6890 tRNA-Sec
    233. Escherichia coli O111:NM str. K6895 tRNA-Sec
    234. Escherichia coli O111:NM str. K6897 tRNA-Sec
    235. Escherichia coli O111:NM str. K6898 tRNA-Sec
    236. Escherichia coli O111:NM str. K6904 tRNA-Sec
    237. Escherichia coli O111:NM str. K6908 tRNA-Sec
    238. Escherichia coli O111:NM str. K6915 tRNA-Sec
    239. Escherichia coli O111:NM tRNA-Sec
    240. Escherichia coli O111 str. RM9322 tRNA-Sec
    241. Escherichia coli O111 tRNA-Sec
    242. Escherichia coli O112ab:H8 tRNA-Sec
    243. Escherichia coli O113:H21 str. 07-4224 tRNA-Sec
    244. Escherichia coli O113:H21 tRNA-Sec
    245. Escherichia coli O113:H36 tRNA-Sec
    246. Escherichia coli O113 tRNA-Sec
    247. Escherichia coli O117 tRNA-Sec
    248. Escherichia coli O118:H16 str. 06-3256 tRNA-Sec
    249. Escherichia coli O118:H16 str. 06-3612 tRNA-Sec
    250. Escherichia coli O118:H16 str. 07-4255 tRNA-Sec
    251. Escherichia coli O118:H16 str. 08-3651 tRNA-Sec
    252. Escherichia coli O118:H16 str. 2009C-4446 tRNA-Sec
    253. Escherichia coli O119:H4 str. 03-3458 tRNA-Sec
    254. Escherichia coli O119 tRNA-Sec
    255. Escherichia coli O11:H15 tRNA-Sec
    256. Escherichia coli O11 tRNA-Sec
    257. Escherichia coli O120:H10 tRNA-Sec
    258. Escherichia coli O121:H19 str. 03-3227 tRNA-Sec
    259. Escherichia coli O121:H19 str. 06-3003 tRNA-Sec
    260. Escherichia coli O121:H19 str. 06-3822 tRNA-Sec
    261. Escherichia coli O121:H19 str. 2009C-4050 tRNA-Sec
    262. Escherichia coli O121:H19 str. 2009C-4659 tRNA-Sec
    263. Escherichia coli O121:H19 str. 2009C-4750 tRNA-Sec
    264. Escherichia coli O121:H19 str. 2009EL1302 tRNA-Sec
    265. Escherichia coli O121:H19 str. 2009EL1412 tRNA-Sec
    266. Escherichia coli O121:H19 str. 2010C-3609 tRNA-Sec
    267. Escherichia coli O121:H19 str. 2010C-3794 tRNA-Sec
    268. Escherichia coli O121:H19 str. 2010C-3840 tRNA-Sec
    269. Escherichia coli O121:H19 str. 2010C-4254 tRNA-Sec
    270. Escherichia coli O121:H19 str. 2010C-4732 tRNA-Sec
    271. Escherichia coli O121:H19 str. 2010C-4824 tRNA-Sec
    272. Escherichia coli O121:H19 str. 2010C-4966 tRNA-Sec
    273. Escherichia coli O121:H19 str. 2010C-4989 tRNA-Sec
    274. Escherichia coli O121:H19 str. 2010EL1058 tRNA-Sec
    275. Escherichia coli O121:H19 str. 2011C-3072 tRNA-Sec
    276. Escherichia coli O121:H19 str. 2011C-3108 tRNA-Sec
    277. Escherichia coli O121:H19 str. 2011C-3216 tRNA-Sec
    278. Escherichia coli O121:H19 str. 2011C-3500 tRNA-Sec
    279. Escherichia coli O121:H19 str. 2011C-3537 tRNA-Sec
    280. Escherichia coli O121:H19 str. 2011C-3609 tRNA-Sec
    281. Escherichia coli O121:H19 str. F6714 tRNA-Sec
    282. Escherichia coli O121:H19 str. K5198 tRNA-Sec
    283. Escherichia coli O121:H19 str. K5269 tRNA-Sec
    284. Escherichia coli O121:H19 tRNA-Sec
    285. Escherichia coli O121:H7 str. 2009C-3299 tRNA-Sec
    286. Escherichia coli O121 str. RM8352 tRNA-Sec
    287. Escherichia coli O121 tRNA-Sec
    288. Escherichia coli O123:H11 str. 2009C-3307 tRNA-Sec
    289. Escherichia coli O124 tRNA-Sec
    290. Escherichia coli O126:H45 tRNA-Sec
    291. Escherichia coli O126 tRNA-Sec
    292. Escherichia coli O127:H6 str. E2348/69 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    293. Escherichia coli O128ac:H12 tRNA-Sec
    294. Escherichia coli O128:H2 str. 2011C-3317 tRNA-Sec
    295. Escherichia coli O128:H42 tRNA-Sec
    296. Escherichia coli O128 tRNA-Sec
    297. Escherichia coli O130 tRNA-Sec
    298. Escherichia coli O132 tRNA-Sec
    299. Escherichia coli O136:H26 tRNA-Sec
    300. Escherichia coli O139:H1 tRNA-Sec
    301. Escherichia coli O139:H28 str. E24377A tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    302. Escherichia coli O13 tRNA-Sec
    303. Escherichia coli O140 tRNA-Sec
    304. Escherichia coli O141:H4 tRNA-Sec
    305. Escherichia coli O143:H4 tRNA-Sec
    306. Escherichia coli O144 tRNA-Sec
    307. Escherichia coli O145:H25 str. 07-3858 tRNA-Sec
    308. Escherichia coli O145:H25 tRNA-Sec
    309. Escherichia coli O145:H28 str. 2009C-3292 tRNA-Sec
    310. Escherichia coli O145:H28 str. 4865/96 tRNA-Sec
    311. Escherichia coli O145:H28 str. RM12581 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    312. Escherichia coli O145:H28 str. RM12761 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    313. Escherichia coli O145:H28 str. RM13514 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    314. Escherichia coli O145:H28 str. RM13516 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    315. Escherichia coli O145:H28 tRNA-Sec
    316. Escherichia coli O145:H34 tRNA-Sec
    317. Escherichia coli O145:NM str. 06-3484 tRNA-Sec
    318. Escherichia coli O145:NM str. 08-4270 tRNA-Sec
    319. Escherichia coli O145:NM str. 2010C-3507 tRNA-Sec
    320. Escherichia coli O145:NM str. 2010C-3508 tRNA-Sec
    321. Escherichia coli O145:NM str. 2010C-3509 tRNA-Sec
    322. Escherichia coli O145:NM str. 2010C-3510 tRNA-Sec
    323. Escherichia coli O145:NM str. 2010C-3511 tRNA-Sec
    324. Escherichia coli O145:NM str. 2010C-3516 tRNA-Sec
    325. Escherichia coli O145:NM str. 2010C-3517 tRNA-Sec
    326. Escherichia coli O145:NM str. 2010C-3518 tRNA-Sec
    327. Escherichia coli O145:NM str. 2010C-3521 tRNA-Sec
    328. Escherichia coli O145:NM str. 2010C-3526 tRNA-Sec
    329. Escherichia coli O145:NM str. 2010C-4557C2 tRNA-Sec
    330. Escherichia coli O145:NM tRNA-Sec
    331. Escherichia coli O145 str. RM9872 tRNA-Sec
    332. Escherichia coli O145 tRNA-Sec
    333. Escherichia coli O146:H21 str. 2010C-3325 tRNA-Sec
    334. Escherichia coli O146 tRNA-Sec
    335. Escherichia coli O14 tRNA-Sec
    336. Escherichia coli O150:H6 tRNA-Sec
    337. Escherichia coli O150 tRNA-Sec
    338. Escherichia coli O151:H8 tRNA-Sec
    339. Escherichia coli O152:H23 tRNA-Sec
    340. Escherichia coli O153:H12 tRNA-Sec
    341. Escherichia coli O153:H2 str. 2010C-5034 tRNA-Sec
    342. Escherichia coli O153 tRNA-Sec
    343. Escherichia coli O156:H25 str. 2011C-3602 tRNA-Sec
    344. Escherichia coli O157:H16 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    345. Escherichia coli O157:H43 tRNA-Sec
    346. Escherichia coli O157:H7 str. 06-3745 tRNA-Sec
    347. Escherichia coli O157:H7 str. 06-4039 tRNA-Sec
    348. Escherichia coli O157:H7 str. 07-3091 tRNA-Sec
    349. Escherichia coli O157:H7 str. 07-3391 tRNA-Sec
    350. Escherichia coli O157:H7 str. 08-3037 tRNA-Sec
    351. Escherichia coli O157:H7 str. 08-3527 tRNA-Sec
    352. Escherichia coli O157:H7 str. 08-4169 tRNA-Sec
    353. Escherichia coli O157:H7 str. 08-4529 tRNA-Sec
    354. Escherichia coli O157:H7 str. 2009C-4258 tRNA-Sec
    355. Escherichia coli O157:H7 str. 2009EL1449 tRNA-Sec
    356. Escherichia coli O157:H7 str. 2009EL1705 tRNA-Sec
    357. Escherichia coli O157:H7 str. 2009EL1913 tRNA-Sec
    358. Escherichia coli O157:H7 str. 2009EL2109 tRNA-Sec
    359. Escherichia coli O157:H7 str. 2010C-4979C1 tRNA-Sec
    360. Escherichia coli O157:H7 str. 2011EL-1107 tRNA-Sec
    361. Escherichia coli O157:H7 str. 2011EL-2090 tRNA-Sec
    362. Escherichia coli O157:H7 str. 2011EL-2091 tRNA-Sec
    363. Escherichia coli O157:H7 str. 2011EL-2092 tRNA-Sec
    364. Escherichia coli O157:H7 str. 2011EL-2093 tRNA-Sec
    365. Escherichia coli O157:H7 str. 2011EL-2094 tRNA-Sec
    366. Escherichia coli O157:H7 str. 2011EL-2096 tRNA-Sec
    367. Escherichia coli O157:H7 str. 2011EL-2097 tRNA-Sec
    368. Escherichia coli O157:H7 str. 2011EL-2098 tRNA-Sec
    369. Escherichia coli O157:H7 str. 2011EL-2099 tRNA-Sec
    370. Escherichia coli O157:H7 str. 2011EL-2101 tRNA-Sec
    371. Escherichia coli O157:H7 str. 2011EL-2103 tRNA-Sec
    372. Escherichia coli O157:H7 str. 2011EL-2104 tRNA-Sec
    373. Escherichia coli O157:H7 str. 2011EL-2105 tRNA-Sec
    374. Escherichia coli O157:H7 str. 2011EL-2106 tRNA-Sec
    375. Escherichia coli O157:H7 str. 2011EL-2107 tRNA-Sec
    376. Escherichia coli O157:H7 str. 2011EL-2108 tRNA-Sec
    377. Escherichia coli O157:H7 str. 2011EL-2109 tRNA-Sec
    378. Escherichia coli O157:H7 str. 2011EL-2111 tRNA-Sec
    379. Escherichia coli O157:H7 str. 2011EL-2112 tRNA-Sec
    380. Escherichia coli O157:H7 str. 2011EL-2113 tRNA-Sec
    381. Escherichia coli O157:H7 str. 2011EL-2114 tRNA-Sec
    382. Escherichia coli O157:H7 str. 2011EL-2286 tRNA-Sec
    383. Escherichia coli O157:H7 str. 2011EL-2287 tRNA-Sec
    384. Escherichia coli O157:H7 str. 2011EL-2288 tRNA-Sec
    385. Escherichia coli O157:H7 str. 2011EL-2289 tRNA-Sec
    386. Escherichia coli O157:H7 str. 2011EL-2290 tRNA-Sec
    387. Escherichia coli O157:H7 str. 2011EL-2312 tRNA-Sec
    388. Escherichia coli O157:H7 str. 2011EL-2313 tRNA-Sec
    389. Escherichia coli O157:H7 str. EC10 tRNA-Sec
    390. Escherichia coli O157:H7 str. EC1825 tRNA-Sec
    391. Escherichia coli O157:H7 str. EC4042 tRNA-Sec
    392. Escherichia coli O157:H7 str. EC4045 tRNA-Sec
    393. Escherichia coli O157:H7 str. EC4076 tRNA-Sec
    394. Escherichia coli O157:H7 str. EC4113 tRNA-Sec
    395. Escherichia coli O157:H7 str. EC4115 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    396. Escherichia coli O157:H7 str. EC4196 tRNA-Sec
    397. Escherichia coli O157:H7 str. EC4206 tRNA-Sec
    398. Escherichia coli O157:H7 str. EC4401 tRNA-Sec
    399. Escherichia coli O157:H7 str. EC4486 tRNA-Sec
    400. Escherichia coli O157:H7 str. EC4501 tRNA-Sec
    401. Escherichia coli O157:H7 str. EC508 tRNA-Sec
    402. Escherichia coli O157:H7 str. EC869 tRNA-Sec
    403. Escherichia coli O157:H7 str. EDL933 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    404. Escherichia coli O157:H7 str. F6142 tRNA-Sec
    405. Escherichia coli O157:H7 str. F6749 tRNA-Sec
    406. Escherichia coli O157:H7 str. F6750 tRNA-Sec
    407. Escherichia coli O157:H7 str. F6751 tRNA-Sec
    408. Escherichia coli O157:H7 str. F7350 tRNA-Sec
    409. Escherichia coli O157:H7 str. F7377 tRNA-Sec
    410. Escherichia coli O157:H7 str. F7384 tRNA-Sec
    411. Escherichia coli O157:H7 str. F7410 tRNA-Sec
    412. Escherichia coli O157:H7 str. F8092B tRNA-Sec
    413. Escherichia coli O157:H7 str. G5101 tRNA-Sec
    414. Escherichia coli O157:H7 str. G5303 tRNA-Sec
    415. Escherichia coli O157:H7 str. H2495 tRNA-Sec
    416. Escherichia coli O157:H7 str. H2498 tRNA-Sec
    417. Escherichia coli O157:H7 str. K1420 tRNA-Sec
    418. Escherichia coli O157:H7 str. K1792 tRNA-Sec
    419. Escherichia coli O157:H7 str. K1793 tRNA-Sec
    420. Escherichia coli O157:H7 str. K1795 tRNA-Sec
    421. Escherichia coli O157:H7 str. K1796 tRNA-Sec
    422. Escherichia coli O157:H7 str. K1845 tRNA-Sec
    423. Escherichia coli O157:H7 str. K1921 tRNA-Sec
    424. Escherichia coli O157:H7 str. K1927 tRNA-Sec
    425. Escherichia coli O157:H7 str. K2188 tRNA-Sec
    426. Escherichia coli O157:H7 str. K2191 tRNA-Sec
    427. Escherichia coli O157:H7 str. K2192 tRNA-Sec
    428. Escherichia coli O157:H7 str. K2324 tRNA-Sec
    429. Escherichia coli O157:H7 str. K2581 tRNA-Sec
    430. Escherichia coli O157:H7 str. K2622 tRNA-Sec
    431. Escherichia coli O157:H7 str. K2845 tRNA-Sec
    432. Escherichia coli O157:H7 str. K2854 tRNA-Sec
    433. Escherichia coli O157:H7 str. K4396 tRNA-Sec
    434. Escherichia coli O157:H7 str. K4405 tRNA-Sec
    435. Escherichia coli O157:H7 str. K4406 tRNA-Sec
    436. Escherichia coli O157:H7 str. K4527 tRNA-Sec
    437. Escherichia coli O157:H7 str. K5418 tRNA-Sec
    438. Escherichia coli O157:H7 str. K5448 tRNA-Sec
    439. Escherichia coli O157:H7 str. K5449 tRNA-Sec
    440. Escherichia coli O157:H7 str. K5453 tRNA-Sec
    441. Escherichia coli O157:H7 str. K5460 tRNA-Sec
    442. Escherichia coli O157:H7 str. K5467 tRNA-Sec
    443. Escherichia coli O157:H7 str. K5602 tRNA-Sec
    444. Escherichia coli O157:H7 str. K5607 tRNA-Sec
    445. Escherichia coli O157:H7 str. K5609 tRNA-Sec
    446. Escherichia coli O157:H7 str. K5806 tRNA-Sec
    447. Escherichia coli O157:H7 str. K5852 tRNA-Sec
    448. Escherichia coli O157:H7 str. K6590 tRNA-Sec
    449. Escherichia coli O157:H7 str. K6676 tRNA-Sec
    450. Escherichia coli O157:H7 str. K6687 tRNA-Sec
    451. Escherichia coli O157:H7 str. K7140 tRNA-Sec
    452. Escherichia coli O157:H7 str. LSU-61 tRNA-Sec
    453. Escherichia coli O157:H7 str. Sakai tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    454. Escherichia coli O157:H7 str. SS17 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    455. Escherichia coli O157:H7 str. SS52 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    456. Escherichia coli O157:H7 str. TW14313 tRNA-Sec
    457. Escherichia coli O157:H7 str. TW14359 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    458. Escherichia coli O157:H7 str. TW14588 tRNA-Sec
    459. Escherichia coli O157:H7 tRNA-SeC
    460. Escherichia coli O157:H- str. 493-89 tRNA-Sec
    461. Escherichia coli O157:H- str. H 2687 tRNA-Sec
    462. Escherichia coli O157:H- tRNA-Sec
    463. Escherichia coli O157:NM str. 08-4540 tRNA-Sec
    464. Escherichia coli O157:NM tRNA-Sec
    465. Escherichia coli O157: str. 2010EL-2044 tRNA-Sec
    466. Escherichia coli O157: str. 2010EL-2045 tRNA-Sec
    467. Escherichia coli O157 tRNA-Sec
    468. Escherichia coli O158:H23 tRNA-Sec
    469. Escherichia coli O159:H19 tRNA-Sec
    470. Escherichia coli O15:H12 tRNA-Sec
    471. Escherichia coli O15:H18 str. K1516 tRNA-Sec
    472. Escherichia coli O15:H21 tRNA-Sec
    473. Escherichia coli O15 tRNA-Sec
    474. Escherichia coli O160 tRNA-Sec
    475. Escherichia coli O163 tRNA-Sec
    476. Escherichia coli O165:H25 str. 2010C-4874 tRNA-Sec
    477. Escherichia coli O166:H49 tRNA-Sec
    478. Escherichia coli O166:H6 tRNA-Sec
    479. Escherichia coli O167:H26 tRNA-Sec
    480. Escherichia coli O167:H9 tRNA-Sec
    481. Escherichia coli O168:H8 tRNA-Sec
    482. Escherichia coli O169:H41 str. F9792 tRNA-Sec
    483. Escherichia coli O16:H48 tRNA-Sec
    484. Escherichia coli O16 tRNA-Sec
    485. Escherichia coli O170:H18 tRNA-Sec
    486. Escherichia coli O174:H21 str. 03-3269 tRNA-Sec
    487. Escherichia coli O174:H7 tRNA-Sec
    488. Escherichia coli O174:H8 str. 04-3038 tRNA-Sec
    489. Escherichia coli O176:H45 tRNA-Sec
    490. Escherichia coli O177:NM str. 2010C-4558 tRNA-Sec
    491. Escherichia coli O177 tRNA-Sec
    492. Escherichia coli O180:H14 tRNA-Sec
    493. Escherichia coli O18ac:H14 tRNA-Sec
    494. Escherichia coli O18:H1 tRNA-Sec
    495. Escherichia coli O18:H7 tRNA-Sec
    496. Escherichia coli O19:H42 tRNA-Sec
    497. Escherichia coli O19:H7 tRNA-Sec
    498. Escherichia coli O19 tRNA-Sec
    499. Escherichia coli O1:H42 tRNA-Sec
    500. Escherichia coli O1:H7 tRNA-Sec
    501. Escherichia coli O1:HNT tRNA-Sec
    502. Escherichia coli O1 tRNA-Sec
    503. Escherichia coli O20:H12 tRNA-Sec
    504. Escherichia coli O21:H28 tRNA-Sec
    505. Escherichia coli O21 tRNA-Sec
    506. Escherichia coli O22:H8 tRNA-Sec
    507. Escherichia coli O24 tRNA-Sec
    508. Escherichia coli O25b:H4-ST131 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    509. Escherichia coli O25b:H4 tRNA-Sec
    510. Escherichia coli O25:H4 tRNA-SeC
    511. Escherichia coli O25:NM str. E2539C1 tRNA-Sec
    512. Escherichia coli O25 tRNA-Sec
    513. Escherichia coli O26:H11 str. 03-3500 tRNA-Sec
    514. Escherichia coli O26:H11 str. 05-3646 tRNA-Sec
    515. Escherichia coli O26:H11 str. 06-3464 tRNA-Sec
    516. Escherichia coli O26:H11 str. 11368 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    517. Escherichia coli O26:H11 str. 2009C-3612 tRNA-Sec
    518. Escherichia coli O26:H11 str. 2009C-3689 tRNA-Sec
    519. Escherichia coli O26:H11 str. 2009C-3996 tRNA-Sec
    520. Escherichia coli O26:H11 str. 2009C-4760 tRNA-Sec
    521. Escherichia coli O26:H11 str. 2009C-4826 tRNA-Sec
    522. Escherichia coli O26:H11 str. 2010C-3051 tRNA-Sec
    523. Escherichia coli O26:H11 str. 2010C-3472 tRNA-Sec
    524. Escherichia coli O26:H11 str. 2010C-3871 tRNA-Sec
    525. Escherichia coli O26:H11 str. 2010C-3902 tRNA-Sec
    526. Escherichia coli O26:H11 str. 2010C-4244 tRNA-Sec
    527. Escherichia coli O26:H11 str. 2010C-4430 tRNA-Sec
    528. Escherichia coli O26:H11 str. 2010C-4819 tRNA-Sec
    529. Escherichia coli O26:H11 str. 2010C-4834 tRNA-Sec
    530. Escherichia coli O26:H11 str. 2010C-5028 tRNA-Sec
    531. Escherichia coli O26:H11 str. 2010EL-1699 tRNA-Sec
    532. Escherichia coli O26:H11 str. 2011C-3270 tRNA-Sec
    533. Escherichia coli O26:H11 str. 2011C-3274 tRNA-Sec
    534. Escherichia coli O26:H11 str. 2011C-3282 tRNA-Sec
    535. Escherichia coli O26:H11 str. 2011C-3387 tRNA-Sec
    536. Escherichia coli O26:H11 str. 2011C-3506 tRNA-Sec
    537. Escherichia coli O26:H11 str. 2011C-3655 tRNA-Sec
    538. Escherichia coli O26:H11 str. CVM10021 tRNA-Sec
    539. Escherichia coli O26:H11 str. CVM9952 tRNA-Sec
    540. Escherichia coli O26:H11 tRNA-Sec
    541. Escherichia coli O26:H1 str. 2009C-4747 tRNA-Sec
    542. Escherichia coli O26:NM str. 2010C-4347 tRNA-Sec
    543. Escherichia coli O26:NM str. 2010C-4788 tRNA-Sec
    544. Escherichia coli O26 str. RM10386 tRNA-Sec
    545. Escherichia coli O26 str. RM8426 tRNA-Sec
    546. Escherichia coli O26 tRNA-Sec
    547. Escherichia coli O28ac:NM str. 02-3404 tRNA-Sec
    548. Escherichia coli O2:H1 tRNA-Sec
    549. Escherichia coli O2:H32 tRNA-Sec
    550. Escherichia coli O2:H6 tRNA-Sec
    551. Escherichia coli O2 tRNA-Sec
    552. Escherichia coli O32 tRNA-Sec
    553. Escherichia coli O33 tRNA-Sec
    554. Escherichia coli O35 tRNA-Sec
    555. Escherichia coli O36:H5 tRNA-Sec
    556. Escherichia coli O36 tRNA-Sec
    557. Escherichia coli O38:H26 tRNA-Sec
    558. Escherichia coli O39:H21 tRNA-Sec
    559. Escherichia coli O39:H4 tRNA-Sec
    560. Escherichia coli O3 tRNA-Sec
    561. Escherichia coli O40:H32 tRNA-Sec
    562. Escherichia coli O43:H14 tRNA-Sec
    563. Escherichia coli O43:H2 tRNA-Sec
    564. Escherichia coli O43 str. RM10042 tRNA-Sec
    565. Escherichia coli O45:H2 str. 01-3147 tRNA-Sec
    566. Escherichia coli O45:H2 str. 2009C-3686 tRNA-Sec
    567. Escherichia coli O45:H2 str. 2009C-4780 tRNA-Sec
    568. Escherichia coli O45:H2 str. 2010C-3876 tRNA-Sec
    569. Escherichia coli O45:H2 str. 2010C-4211 tRNA-Sec
    570. Escherichia coli O45:H2 tRNA-Sec
    571. Escherichia coli O49:H9 tRNA-Sec
    572. Escherichia coli O53 tRNA-Sec
    573. Escherichia coli O55:H7 str. 06-3555 tRNA-Sec
    574. Escherichia coli O55:H7 str. 3256-97 tRNA-Sec
    575. Escherichia coli O55:H7 str. CB9615 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    576. Escherichia coli O55:H7 str. RM12579 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    577. Escherichia coli O55:H7 str. TB182A tRNA-Sec
    578. Escherichia coli O55:H7 str. USDA 5905 tRNA-Sec
    579. Escherichia coli O55:H7 tRNA-Sec
    580. Escherichia coli O55 tRNA-Sec
    581. Escherichia coli O5 tRNA-Sec
    582. Escherichia coli O68:H12 tRNA-Sec
    583. Escherichia coli O69:H11 str. 06-3325 tRNA-Sec
    584. Escherichia coli O69:H11 str. 07-3763 tRNA-Sec
    585. Escherichia coli O69:H11 str. 07-4281 tRNA-Sec
    586. Escherichia coli O69:H11 str. 08-4661 tRNA-Sec
    587. Escherichia coli O69:H11 str. 2009C-3601 tRNA-Sec
    588. Escherichia coli O6:H16:CFA/II str. B2C tRNA-Sec
    589. Escherichia coli O6:H16 str. 99-3165 tRNA-Sec
    590. Escherichia coli O6:H16 str. F5656C1 tRNA-Sec
    591. Escherichia coli O6:H34 tRNA-Sec
    592. Escherichia coli O6 tRNA-Sec
    593. Escherichia coli O70:H25 tRNA-Sec
    594. Escherichia coli O73 tRNA-Sec
    595. Escherichia coli O74:H8 tRNA-Sec
    596. Escherichia coli O74 tRNA-Sec
    597. Escherichia coli O78:H12 str. 00-3279 tRNA-Sec
    598. Escherichia coli O78:H42 tRNA-Sec
    599. Escherichia coli O78 tRNA-Sec
    600. Escherichia coli O79:H7 str. 06-3501 tRNA-Sec
    601. Escherichia coli O7:H4 tRNA-Sec
    602. Escherichia coli O7:H7 tRNA-Sec
    603. Escherichia coli O7:K1 str. CE10 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    604. Escherichia coli O80:H26 tRNA-Sec
    605. Escherichia coli O80:H45 tRNA-Sec
    606. Escherichia coli O81:NM str. 02-3012 tRNA-Sec
    607. Escherichia coli O83:H1 str. NRG 857C tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    608. Escherichia coli O83:H31 tRNA-Sec
    609. Escherichia coli O83 tRNA-Sec
    610. Escherichia coli O84:H7 tRNA-Sec
    611. Escherichia coli O85:H1 tRNA-Sec
    612. Escherichia coli O86:H34 str. 99-3124 tRNA-Sec
    613. Escherichia coli O86:H8 tRNA-Sec
    614. Escherichia coli O88:H1 tRNA-Sec
    615. Escherichia coli O88:H4 tRNA-Sec
    616. Escherichia coli O89m:H10 tRNA-Sec
    617. Escherichia coli O89m:H9 tRNA-Sec
    618. Escherichia coli O8:H19 tRNA-Sec
    619. Escherichia coli O8:H28 tRNA-Sec
    620. Escherichia coli O8:H31 tRNA-Sec
    621. Escherichia coli O8:H36 tRNA-Sec
    622. Escherichia coli O8:H49 tRNA-Sec
    623. Escherichia coli O8:H8 tRNA-SeC
    624. Escherichia coli O8:H9 tRNA-Sec
    625. Escherichia coli O8 tRNA-Sec
    626. Escherichia coli O91:H14 str. 06-3691 tRNA-Sec
    627. Escherichia coli O91:H14 str. 2009C-3227 tRNA-Sec
    628. Escherichia coli O91:H21 str. 2009C-3740 tRNA-Sec
    629. Escherichia coli O91:H21 str. 2009C-4646 tRNA-Sec
    630. Escherichia coli O91:H21 tRNA-Sec
    631. Escherichia coli O91:H28 tRNA-Sec
    632. Escherichia coli O91:NM str. 2009C-3745 tRNA-Sec
    633. Escherichia coli O91 str. RM7190 tRNA-Sec
    634. Escherichia coli O91 tRNA-Sec
    635. Escherichia coli O96 tRNA-Sec
    636. Escherichia coli O99:H27 tRNA-Sec
    637. Escherichia coli O9:H10 tRNA-Sec
    638. Escherichia coli OP50 tRNA-Sec
    639. Escherichia coli OX01:H8 tRNA-Sec
    640. Escherichia coli OX38:H47 tRNA-Sec
    641. Escherichia coli P12b tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    642. Escherichia coli P4-96 tRNA-Sec
    643. Escherichia coli P4-NR tRNA-Sec
    644. Escherichia coli PMV-1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    645. Escherichia coli RS218 tRNA-Sec
    646. Escherichia coli S17 tRNA-Sec
    647. Escherichia coli S88 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    648. Escherichia coli SCI-07 tRNA-Sec
    649. Escherichia coli SE11 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    650. Escherichia coli SE15 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    651. Escherichia coli SEPT362 tRNA-Sec
    652. Escherichia coli SHECO002 tRNA-Sec
    653. Escherichia coli SHECO003 tRNA-Sec
    654. Escherichia coli SMS-3-5 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    655. Escherichia coli str. 'clone D i14' tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    656. Escherichia coli str. 'clone D i2' tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    657. Escherichia coli str. K-12 substr. DH10B tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    658. Escherichia coli str. K-12 substr. MC4100 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    659. Escherichia coli str. K-12 substr. MDS42 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    660. Escherichia coli str. K-12 substr. W3110 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    661. Escherichia coli str. Sanji tRNA-Sec
    662. Escherichia coli tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    663. Escherichia coli UCI 52 tRNA-Sec
    664. Escherichia coli UM146 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    665. Escherichia coli UMEA 3252-1 tRNA-Sec
    666. Escherichia coli UMN026 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    667. Escherichia coli UMNF18 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    668. Escherichia coli UMNK88 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    669. Escherichia coli UTI89 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    670. Escherichia coli VL2732 tRNA-Sec
    671. Escherichia coli VL2874 tRNA-Sec
    672. Escherichia coli VR50 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    673. Escherichia coli W tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    674. Escherichia coli XH001 tRNA-Sec
    675. Escherichia coli XH140A tRNA-Sec
    676. Escherichia coli Xuzhou21 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    677. Escherichia fergusonii ATCC 35469 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    678. Escherichia fergusonii tRNA-seC(tca)
    679. Escherichia marmotae tRNA-Sec
    680. Escherichia ruysiae tRNA-Sec
    681. Escherichia sp. 0.2392 tRNA-Sec
    682. Escherichia sp. 11.1596 tRNA-Sec
    683. Escherichia sp. 11.1597 tRNA-Sec
    684. Escherichia sp. 11.1600 tRNA-Sec
    685. Escherichia sp. 12.2610 tRNA-Sec
    686. Escherichia sp. 12.2612 tRNA-Sec
    687. Escherichia sp. 14.0982 tRNA-Sec
    688. Escherichia sp. 14.0985 tRNA-Sec
    689. Escherichia sp. 14.0993 tRNA-Sec
    690. Escherichia sp. 20412-1 tRNA-Sec
    691. Escherichia sp. 4726-5 tRNA-Sec
    692. Escherichia sp. 79.0191 tRNA-Sec
    693. Escherichia sp. 8.2195 tRNA-Sec
    694. Escherichia sp. 92.1228 tRNA-Sec
    695. Escherichia sp. 93.0724 tRNA-Sec
    696. Escherichia sp. 93.0743 tRNA-Sec
    697. Escherichia sp. 93.0750 tRNA-Sec
    698. Escherichia sp. 93.0816 tRNA-Sec
    699. Escherichia sp. 93.1447 tRNA-Sec
    700. Escherichia sp. 93.1462 tRNA-Sec
    701. Escherichia sp. 93.1518 tRNA-Sec
    702. Escherichia sp. 94.0001 tRNA-Sec
    703. Escherichia sp. E10V10 tRNA-Sec
    704. Escherichia sp. E10V4 tRNA-Sec
    705. Escherichia sp. E10V5 tRNA-Sec
    706. Escherichia sp. E1130 tRNA-Sec
    707. Escherichia sp. E13S3 tRNA-Sec
    708. Escherichia sp. E14S1 tRNA-Sec
    709. Escherichia sp. E14V10 tRNA-Sec
    710. Escherichia sp. E14V5 tRNA-Sec
    711. Escherichia sp. E14V7 tRNA-Sec
    712. Escherichia sp. E1S7 tRNA-Sec
    713. Escherichia sp. E1V33 tRNA-Sec
    714. Escherichia sp. E2562 tRNA-Sec
    715. Escherichia sp. E2586 tRNA-Sec
    716. Escherichia sp. E2593 tRNA-Sec
    717. Escherichia sp. E2661 tRNA-Sec
    718. Escherichia sp. E2748 tRNA-Sec
    719. Escherichia sp. E3356 tRNA-Sec
    720. Escherichia sp. E3659 tRNA-Sec
    721. Escherichia sp. E4208 tRNA-Sec
    722. Escherichia sp. E4385 tRNA-Sec
    723. Escherichia sp. E4694 tRNA-Sec
    724. Escherichia sp. E4702 tRNA-Sec
    725. Escherichia sp. E4736 tRNA-Sec
    726. Escherichia sp. E4742 tRNA-Sec
    727. Escherichia sp. E4930 tRNA-Sec
    728. Escherichia sp. E5028 tRNA-Sec
    729. Escherichia sp. Gen1 tRNA-Sec
    730. Escherichia sp. HH26CH tRNA-Sec
    731. Escherichia sp. HH41S tRNA-Sec
    732. Escherichia sp. JL983 tRNA-Sec
    733. Escherichia sp. KCJ4928 tRNA-Sec
    734. Escherichia sp. KCJ4943 tRNA-Sec
    735. Escherichia sp. L7 tRNA-Sec
    736. Escherichia sp. MOD1-EC5451 tRNA-Sec
    737. Escherichia sp. MOD1-EC6475 tRNA-Sec
    738. Escherichia sp. MR tRNA-Sec
    739. Escherichia sp. NIC32-2 tRNA-Sec
    740. Escherichia sp. NT45 tRNA-Sec
    741. Escherichia sp. R8 tRNA-Sec
    742. Escherichia sp. S69_ASV_4 tRNA-Sec
    743. Escherichia sp. S85_ASV_4 tRNA-Sec
    744. Escherichia whittamii tRNA-Sec
    745. Escherichia sp. SCLE84 tRNA-Sec
    746. Escherichia sp. TC-EC600-tetX4 tRNA-Sec
    747. Escherichia sp. TM-G17TGC tRNA-Sec
    748. Escherichia sp. (wastewater metagenome) tRNA-Sec
    749. Franconibacter daqui tRNA-Sec
    750. Franconibacter pulveris tRNA-Sec
    751. Jejubacter calystegiae tRNA-Sec
    752. Klebsiella oxytoca tRNA-seC(tca)
    753. Klebsiella pneumoniae tRNA-seC(tca)
    754. Klebsiella sp. STW0522-44 tRNA-SeC
    755. Klebsiella sp. WP3-S18-ESBL-05 tRNA-SeC
    756. Klebsiella sp. WP3-W18-ESBL-02 tRNA-SeC
    757. Klebsiella sp. WP4-W18-ESBL-05 tRNA-SeC
    758. Klebsiella sp. WP8-S18-ESBL-06 tRNA-SeC
    759. Kluyvera ascorbata ATCC 33433 tRNA-Sec
    760. Kluyvera ascorbata tRNA-SeC
    761. Kluyvera genomosp. 3 tRNA-Sec
    762. Kluyvera georgiana ATCC 51603 tRNA-Sec
    763. Kluyvera georgiana tRNA-Sec
    764. Kluyvera sichuanensis tRNA-Sec
    765. Pantoea coffeiphila tRNA-Sec
    766. Salmonella bongori CFSAN000510 tRNA-Sec
    767. Salmonella bongori N268-08 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    768. Salmonella bongori NCTC 12419 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    769. Salmonella bongori serovar 40:z35:- str. 95-0123 tRNA-Sec
    770. Salmonella bongori serovar 40:z35:- tRNA-Sec
    771. Salmonella bongori serovar 44:r:- tRNA-Sec
    772. Salmonella bongori serovar 48:i:- str. 94-0708 tRNA-Sec
    773. Salmonella bongori serovar 48:i:- tRNA-Sec
    774. Salmonella bongori serovar 48:z35:- tRNA-Sec
    775. Salmonella bongori serovar 48:z41:-- str. RKS3044 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    776. Salmonella bongori serovar 66:z41:- str. SA19983605 tRNA-Sec
    777. Salmonella bongori serovar 66:z65:- tRNA-Sec
    778. Salmonella bongori tRNA-seC(tca)
    779. Salmonella enterica subsp. arizonae serovar [1],13,23:g,z51:- tRNA-Sec
    780. Salmonella enterica subsp. arizonae serovar 13,23:gz51:- tRNA-Sec
    781. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N23850 tRNA-Sec
    782. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N7307 tRNA-Sec
    783. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- tRNA-Sec
    784. Salmonella enterica subsp. arizonae serovar 18:z4,z32:- tRNA-Sec
    785. Salmonella enterica subsp. arizonae serovar 38:z4,z23:- tRNA-Sec
    786. Salmonella enterica subsp. arizonae serovar 40:z4,z24: tRNA-Sec
    787. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- tRNA-Sec
    788. Salmonella enterica subsp. arizonae serovar 44:z4,z23,z32:- tRNA-Sec
    789. Salmonella enterica subsp. arizonae serovar 47:z4,z23:- tRNA-Sec
    790. Salmonella enterica subsp. arizonae serovar 50:r:z tRNA-Sec
    791. Salmonella enterica subsp. arizonae serovar 51:g,z51:- tRNA-Sec
    792. Salmonella enterica subsp. arizonae serovar 56:z4,z23:- tRNA-Sec
    793. Salmonella enterica subsp. arizonae serovar 63:g,z51:- str. So 20/20 tRNA-Sec
    794. Salmonella enterica subsp. arizonae tRNA-Sec
    795. Salmonella enterica subsp. diarizonae serovar 11:k:z53 tRNA-Sec
    796. Salmonella enterica subsp. diarizonae serovar 16:z10:e,n,x,z15 tRNA-Sec
    797. Salmonella enterica subsp. diarizonae serovar 35:k:e,n,x,z15 tRNA-Sec
    798. Salmonella enterica subsp. diarizonae serovar 38:[k]:- tRNA-Sec
    799. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35 tRNA-Sec
    800. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35:- tRNA-Sec
    801. Salmonella enterica subsp. diarizonae serovar 38:k:z tRNA-Sec
    802. Salmonella enterica subsp. diarizonae serovar 47:k:z35 tRNA-Sec
    803. Salmonella enterica subsp. diarizonae serovar 47:k:z53:[z84] tRNA-Sec
    804. Salmonella enterica subsp. diarizonae serovar 48:i:z tRNA-Sec
    805. Salmonella enterica subsp. diarizonae serovar 48:z52:z tRNA-Sec
    806. Salmonella enterica subsp. diarizonae serovar 50:k:z str. MZ0080 tRNA-Sec
    807. Salmonella enterica subsp. diarizonae serovar 50:k:z tRNA-Sec
    808. Salmonella enterica subsp. diarizonae serovar 50:k:z:[z50],[z57],[z68], [z86] tRNA-Sec
    809. Salmonella enterica subsp. diarizonae serovar 50:l,v:z35 tRNA-Sec
    810. Salmonella enterica subsp. diarizonae serovar 50:r:z tRNA-Sec
    811. Salmonella enterica subsp. diarizonae serovar 50:z:z52 tRNA-Sec
    812. Salmonella enterica subsp. diarizonae serovar 53:r:z35 tRNA-Sec
    813. Salmonella enterica subsp. diarizonae serovar 53:z10:- tRNA-Sec
    814. Salmonella enterica subsp. diarizonae serovar 59:[k]:z35 tRNA-Sec
    815. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 str. 01-0170 tRNA-Sec
    816. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 tRNA-Sec
    817. Salmonella enterica subsp. diarizonae serovar 61:-:1,5,7 tRNA-Sec
    818. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,(7) tRNA-Sec
    819. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,7 tRNA-Sec
    820. Salmonella enterica subsp. diarizonae serovar 61:l,v:1,5,7 tRNA-Sec
    821. Salmonella enterica subsp. diarizonae serovar 61:l,[v],[z13]:1,5,[7] tRNA-Sec
    822. Salmonella enterica subsp. diarizonae serovar 61:l,v:z35 tRNA-Sec
    823. Salmonella enterica subsp. diarizonae serovar 61:r:z53 tRNA-Sec
    824. Salmonella enterica subsp. diarizonae serovar 61:r:z tRNA-Sec
    825. Salmonella enterica subsp. diarizonae serovar 61:z52:z53 tRNA-Sec
    826. Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 tRNA-Sec
    827. Salmonella enterica subsp. diarizonae serovar 65:z10:e,n,x,z15 tRNA-Sec
    828. Salmonella enterica subsp. diarizonae serovar b,50:-:- tRNA-Sec
    829. Salmonella enterica subsp. diarizonae serovar Rough:r:z tRNA-Sec
    830. Salmonella enterica subsp. diarizonae serovar Rough:-:- tRNA-Sec
    831. Salmonella enterica subsp. diarizonae str. CFSAN000553 tRNA-Sec
    832. Salmonella enterica subsp. diarizonae str. CFSAN000558 tRNA-Sec
    833. Salmonella enterica subsp. diarizonae tRNA-Sec
    834. Salmonella enterica subsp. enterica serovar 1,3,19:g,m,t:- tRNA-Sec
    835. Salmonella enterica subsp. enterica serovar 13,23:b:- tRNA-Sec
    836. Salmonella enterica subsp. enterica serovar 13,23:i:- tRNA-Sec
    837. Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- tRNA-Sec
    838. Salmonella enterica subsp. enterica serovar 16:b:- tRNA-Sec
    839. Salmonella enterica subsp. enterica serovar 1,9,12:-:- tRNA-Sec
    840. Salmonella enterica subsp. enterica serovar 3,10:e,h:- tRNA-Sec
    841. Salmonella enterica subsp. enterica serovar 4,12:d:- tRNA-Sec
    842. Salmonella enterica subsp. enterica serovar 4,12:i:- tRNA-Sec
    843. Salmonella enterica subsp. enterica serovar 4:-:1,2 tRNA-Sec
    844. Salmonella enterica subsp. enterica serovar 43:a:1,7 tRNA-Sec
    845. Salmonella enterica subsp. enterica serovar 44:z10:1,7 tRNA-Sec
    846. Salmonella enterica subsp. enterica serovar 4,5,12,27:- tRNA-Sec
    847. Salmonella enterica subsp. enterica serovar 4,[5],12:b:- tRNA-Sec
    848. Salmonella enterica subsp. enterica serovar 4,5,12:b:- tRNA-Sec
    849. Salmonella enterica subsp. enterica serovar 4,[5],12:d:- tRNA-Sec
    850. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1700 tRNA-Sec
    851. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    852. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1739 tRNA-Sec
    853. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701 tRNA-Sec
    854. Salmonella enterica subsp. enterica serovar 4,5,12:i tRNA-Sec
    855. Salmonella enterica subsp. enterica serovar 4,5,12:i- tRNA-Sec
    856. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- tRNA-SeC
    857. Salmonella enterica subsp. enterica serovar 4,[5],12:r:- tRNA-Sec
    858. Salmonella enterica subsp. enterica serovar [5],12,[27]:d:- tRNA-Sec
    859. Salmonella enterica subsp. enterica serovar 51:z:1,5 tRNA-Sec
    860. Salmonella enterica subsp. enterica serovar 6,7,14:g,m[p],s:[1,2,7] tRNA-Sec
    861. Salmonella enterica subsp. enterica serovar 6,7,[14]:r:- tRNA-Sec
    862. Salmonella enterica subsp. enterica serovar 6,7:-:1,5 tRNA-Sec
    863. Salmonella enterica subsp. enterica serovar 6,7:b:- tRNA-Sec
    864. Salmonella enterica subsp. enterica serovar 6,7:c:1,5 tRNA-Sec
    865. Salmonella enterica subsp. enterica serovar 6,7:e,h:- tRNA-Sec
    866. Salmonella enterica subsp. enterica serovar 6,7:l,v:- tRNA-Sec
    867. Salmonella enterica subsp. enterica serovar 6,7:-:- tRNA-Sec
    868. Salmonella enterica subsp. enterica serovar 6,8:-:1,2 tRNA-Sec
    869. Salmonella enterica subsp. enterica serovar 6,8,20:d- tRNA-Sec
    870. Salmonella enterica subsp. enterica serovar 6,8:d:- tRNA-Sec
    871. Salmonella enterica subsp. enterica serovar 6,8:i:- tRNA-Sec
    872. Salmonella enterica subsp. enterica serovar 7:d:z35 tRNA-Sec
    873. Salmonella enterica subsp. enterica serovar 8,(20):i:- tRNA-Sec
    874. Salmonella enterica subsp. enterica serovar 8,(20):-:z6 tRNA-Sec
    875. Salmonella enterica subsp. enterica serovar 9,12:-:1,5 tRNA-Sec
    876. Salmonella enterica subsp. enterica serovar 9,12:l,v:- str. 94293 tRNA-Sec
    877. Salmonella enterica subsp. enterica serovar 9,12:l,z28:- tRNA-Sec
    878. Salmonella enterica subsp. enterica serovar 9,12:- tRNA-Sec
    879. Salmonella enterica subsp. enterica serovar 9,12:-:- tRNA-Sec
    880. Salmonella enterica subsp. enterica serovar Abaetetuba str. ATCC 35640 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    881. Salmonella enterica subsp. enterica serovar Abaetetuba tRNA-Sec
    882. Salmonella enterica subsp. enterica serovar Aba tRNA-Sec
    883. Salmonella enterica subsp. enterica serovar Aberdeen tRNA-Sec
    884. Salmonella enterica subsp. enterica serovar Abony str. 0014 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    885. Salmonella enterica subsp. enterica serovar Abony tRNA-Sec
    886. Salmonella enterica subsp. enterica serovar Abortusequi tRNA-Sec
    887. Salmonella enterica subsp. enterica serovar Abortusovis tRNA-Sec
    888. Salmonella enterica subsp. enterica serovar Adabraka tRNA-Sec
    889. Salmonella enterica subsp. enterica serovar Adamstua tRNA-Sec
    890. Salmonella enterica subsp. enterica serovar Adelaide tRNA-Sec
    891. Salmonella enterica subsp. enterica serovar Adjame tRNA-Sec
    892. Salmonella enterica subsp. enterica serovar Afula tRNA-Sec
    893. Salmonella enterica subsp. enterica serovar Agama tRNA-Sec
    894. Salmonella enterica subsp. enterica serovar Agbeni tRNA-Sec
    895. Salmonella enterica subsp. enterica serovar Agona str. 0292 tRNA-Sec
    896. Salmonella enterica subsp. enterica serovar Agona str. 0322 tRNA-Sec
    897. Salmonella enterica subsp. enterica serovar Agona str. 241981 tRNA-Sec
    898. Salmonella enterica subsp. enterica serovar Agona str. 24249 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    899. Salmonella enterica subsp. enterica serovar Agona str. 246555-3 tRNA-Sec
    900. Salmonella enterica subsp. enterica serovar Agona str. 266757-1 tRNA-Sec
    901. Salmonella enterica subsp. enterica serovar Agona str. 311387-1 tRNA-Sec
    902. Salmonella enterica subsp. enterica serovar Agona str. 339787 tRNA-Sec
    903. Salmonella enterica subsp. enterica serovar Agona str. 392869-1 tRNA-Sec
    904. Salmonella enterica subsp. enterica serovar Agona str. 392869-2 tRNA-Sec
    905. Salmonella enterica subsp. enterica serovar Agona str. 400095 11 tRNA-Sec
    906. Salmonella enterica subsp. enterica serovar Agona str. 400095 13 tRNA-Sec
    907. Salmonella enterica subsp. enterica serovar Agona str. 400095 14 tRNA-Sec
    908. Salmonella enterica subsp. enterica serovar Agona str. 400095 17 tRNA-Sec
    909. Salmonella enterica subsp. enterica serovar Agona str. 400095 18 tRNA-Sec
    910. Salmonella enterica subsp. enterica serovar Agona str. 400095 19 tRNA-Sec
    911. Salmonella enterica subsp. enterica serovar Agona str. 400095 22 tRNA-Sec
    912. Salmonella enterica subsp. enterica serovar Agona str. 400096 16 tRNA-Sec
    913. Salmonella enterica subsp. enterica serovar Agona str. 400100 30-11 tRNA-Sec
    914. Salmonella enterica subsp. enterica serovar Agona str. 400100 5-3 tRNA-Sec
    915. Salmonella enterica subsp. enterica serovar Agona str. 400100 6-5 tRNA-Sec
    916. Salmonella enterica subsp. enterica serovar Agona str. 400100 7-9 tRNA-Sec
    917. Salmonella enterica subsp. enterica serovar Agona str. 409753-6 tRNA-Sec
    918. Salmonella enterica subsp. enterica serovar Agona str. 419639 2-1 tRNA-Sec
    919. Salmonella enterica subsp. enterica serovar Agona str. 432613 tRNA-Sec
    920. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-4 tRNA-Sec
    921. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-5 tRNA-Sec
    922. Salmonella enterica subsp. enterica serovar Agona str. 447967 1-1 tRNA-Sec
    923. Salmonella enterica subsp. enterica serovar Agona str. 447967 2-1 tRNA-Sec
    924. Salmonella enterica subsp. enterica serovar Agona str. 460004 1-1 tRNA-Sec
    925. Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    926. Salmonella enterica subsp. enterica serovar Agona str. 557928 tRNA-Sec
    927. Salmonella enterica subsp. enterica serovar Agona str. 620239 tRNA-Sec
    928. Salmonella enterica subsp. enterica serovar Agona str. 632182-2 tRNA-Sec
    929. Salmonella enterica subsp. enterica serovar Agona str. 648586-1 tRNA-Sec
    930. Salmonella enterica subsp. enterica serovar Agona str. ATCC 51957 tRNA-Sec
    931. Salmonella enterica subsp. enterica serovar Agona str. ATCC BAA-707 tRNA-Sec
    932. Salmonella enterica subsp. enterica serovar Agona str. SA-1 tRNA-Sec
    933. Salmonella enterica subsp. enterica serovar Agona str. SA-2 tRNA-Sec
    934. Salmonella enterica subsp. enterica serovar Agona str. SA-3 tRNA-Sec
    935. Salmonella enterica subsp. enterica serovar Agona str. SA-4 tRNA-Sec
    936. Salmonella enterica subsp. enterica serovar Agona str. SA-5 tRNA-Sec
    937. Salmonella enterica subsp. enterica serovar Agona str. SH08SF124 tRNA-Sec
    938. Salmonella enterica subsp. enterica serovar Agona str. SH10GFN094 tRNA-Sec
    939. Salmonella enterica subsp. enterica serovar Agona str. SH11G1113 tRNA-Sec
    940. Salmonella enterica subsp. enterica serovar Agona str. SL483 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    941. Salmonella enterica subsp. enterica serovar Agona tRNA-Sec
    942. Salmonella enterica subsp. enterica serovar Ago tRNA-Sec
    943. Salmonella enterica subsp. enterica serovar Agoueve tRNA-Sec
    944. Salmonella enterica subsp. enterica serovar Ahuza tRNA-Sec
    945. Salmonella enterica subsp. enterica serovar Ajiobo tRNA-Sec
    946. Salmonella enterica subsp. enterica serovar Akanji tRNA-Sec
    947. Salmonella enterica subsp. enterica serovar Alabama tRNA-Sec
    948. Salmonella enterica subsp. enterica serovar Alachua tRNA-Sec
    949. Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 tRNA-Sec
    950. Salmonella enterica subsp. enterica serovar Albany tRNA-Sec
    951. Salmonella enterica subsp. enterica serovar Albert tRNA-Sec
    952. Salmonella enterica subsp. enterica serovar Altendorf tRNA-Sec
    953. Salmonella enterica subsp. enterica serovar Altona tRNA-Sec
    954. Salmonella enterica subsp. enterica serovar Amager tRNA-Sec
    955. Salmonella enterica subsp. enterica serovar Amersfoort tRNA-Sec
    956. Salmonella enterica subsp. enterica serovar Amoutive tRNA-Sec
    957. Salmonella enterica subsp. enterica serovar Amsterdam tRNA-Sec
    958. Salmonella enterica subsp. enterica serovar Amsterdam var. 15+,34+ tRNA-Sec
    959. Salmonella enterica subsp. enterica serovar Anatum str. ATCC BAA-1592 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    960. Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    961. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN000511 tRNA-Sec
    962. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 tRNA-Sec
    963. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003962 tRNA-Sec
    964. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003963 tRNA-Sec
    965. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003964 tRNA-Sec
    966. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003967 tRNA-Sec
    967. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003970 tRNA-Sec
    968. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003971 tRNA-Sec
    969. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003972 tRNA-Sec
    970. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003973 tRNA-Sec
    971. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003974 tRNA-Sec
    972. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003975 tRNA-Sec
    973. Salmonella enterica subsp. enterica serovar Anatum str. USDA 100 tRNA-Sec
    974. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    975. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 tRNA-Sec
    976. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 tRNA-Sec
    977. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 tRNA-Sec
    978. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 tRNA-Sec
    979. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 tRNA-Sec
    980. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 tRNA-Sec
    981. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 tRNA-Sec
    982. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 tRNA-Sec
    983. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 tRNA-Sec
    984. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 tRNA-Sec
    985. Salmonella enterica subsp. enterica serovar Anatum tRNA-Sec
    986. Salmonella enterica subsp. enterica serovar Anatum var. 15+ tRNA-Sec
    987. Salmonella enterica subsp. enterica serovar Anderlecht tRNA-Sec
    988. Salmonella enterica subsp. enterica serovar Anecho tRNA-Sec
    989. Salmonella enterica subsp. enterica serovar Anfo tRNA-Sec
    990. Salmonella enterica subsp. enterica serovar Angoda tRNA-Sec
    991. Salmonella enterica subsp. enterica serovar Ank tRNA-Sec
    992. Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 tRNA-Sec
    993. Salmonella enterica subsp. enterica serovar Antsalova tRNA-Sec
    994. Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 tRNA-Sec
    995. Salmonella enterica subsp. enterica serovar Apapa tRNA-Sec
    996. Salmonella enterica subsp. enterica serovar Apeyeme tRNA-Sec
    997. Salmonella enterica subsp. enterica serovar Aqua str. NVSL2001 tRNA-Sec
    998. Salmonella enterica subsp. enterica serovar Arechavaleta tRNA-Sec
    999. Salmonella enterica subsp. enterica serovar Arkansas tRNA-Sec
    1000. Salmonella enterica subsp. enterica serovar Aschersleben tRNA-Sec
    1001. Salmonella enterica subsp. enterica serovar Augustenborg tRNA-Sec
    1002. Salmonella enterica subsp. enterica serovar Austin tRNA-Sec
    1003. Salmonella enterica subsp. enterica serovar Baguida tRNA-Sec
    1004. Salmonella enterica subsp. enterica serovar Bahati tRNA-Sec
    1005. Salmonella enterica subsp. enterica serovar Bahrenfeld tRNA-Sec
    1006. Salmonella enterica subsp. enterica serovar Baildon tRNA-Sec
    1007. Salmonella enterica subsp. enterica serovar Bakau tRNA-Sec
    1008. Salmonella enterica subsp. enterica serovar Ball tRNA-Sec
    1009. Salmonella enterica subsp. enterica serovar Banana tRNA-Sec
    1010. Salmonella enterica subsp. enterica serovar Bardo tRNA-Sec
    1011. Salmonella enterica subsp. enterica serovar Bareilly str. 2780 tRNA-Sec
    1012. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000178 tRNA-Sec
    1013. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000179 tRNA-Sec
    1014. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000180 tRNA-Sec
    1015. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000181 tRNA-Sec
    1016. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000182 tRNA-Sec
    1017. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000184 tRNA-Sec
    1018. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000185 tRNA-Sec
    1019. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000186 tRNA-Sec
    1020. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000187 tRNA-Sec
    1021. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000188 tRNA-Sec
    1022. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1023. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000190 tRNA-Sec
    1024. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000191 tRNA-Sec
    1025. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000192 tRNA-Sec
    1026. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000193 tRNA-Sec
    1027. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000194 tRNA-Sec
    1028. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000195 tRNA-Sec
    1029. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000196 tRNA-Sec
    1030. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000198 tRNA-Sec
    1031. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000199 tRNA-Sec
    1032. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000201 tRNA-Sec
    1033. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000202 tRNA-Sec
    1034. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000203 tRNA-Sec
    1035. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000204 tRNA-Sec
    1036. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000205 tRNA-Sec
    1037. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000206 tRNA-Sec
    1038. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000207 tRNA-Sec
    1039. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000208 tRNA-Sec
    1040. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000209 tRNA-Sec
    1041. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000210 tRNA-Sec
    1042. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000211 tRNA-Sec
    1043. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000212 tRNA-Sec
    1044. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000213 tRNA-Sec
    1045. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000214 tRNA-Sec
    1046. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000215 tRNA-Sec
    1047. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000216 tRNA-Sec
    1048. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000217 tRNA-Sec
    1049. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000218 tRNA-Sec
    1050. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000219 tRNA-Sec
    1051. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000220 tRNA-Sec
    1052. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000221 tRNA-Sec
    1053. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000222 tRNA-Sec
    1054. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000223 tRNA-Sec
    1055. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000224 tRNA-Sec
    1056. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000225 tRNA-Sec
    1057. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000226 tRNA-Sec
    1058. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000227 tRNA-Sec
    1059. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000228 tRNA-Sec
    1060. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000229 tRNA-Sec
    1061. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000230 tRNA-Sec
    1062. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000231 tRNA-Sec
    1063. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000232 tRNA-Sec
    1064. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000233 tRNA-Sec
    1065. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000235 tRNA-Sec
    1066. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000236 tRNA-Sec
    1067. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000661 tRNA-Sec
    1068. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000662 tRNA-Sec
    1069. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 tRNA-Sec
    1070. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000680 tRNA-Sec
    1071. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000700 tRNA-Sec
    1072. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 tRNA-Sec
    1073. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000753 tRNA-Sec
    1074. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000754 tRNA-Sec
    1075. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000755 tRNA-Sec
    1076. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000951 tRNA-Sec
    1077. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000952 tRNA-Sec
    1078. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000953 tRNA-Sec
    1079. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000954 tRNA-Sec
    1080. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000955 tRNA-Sec
    1081. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000956 tRNA-Sec
    1082. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000957 tRNA-Sec
    1083. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000958 tRNA-Sec
    1084. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000959 tRNA-Sec
    1085. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000960 tRNA-Sec
    1086. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000961 tRNA-Sec
    1087. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000962 tRNA-Sec
    1088. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000963 tRNA-Sec
    1089. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000964 tRNA-Sec
    1090. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000965 tRNA-Sec
    1091. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000966 tRNA-Sec
    1092. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000967 tRNA-Sec
    1093. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 tRNA-Sec
    1094. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000969 tRNA-Sec
    1095. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000970 tRNA-Sec
    1096. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001087 tRNA-Sec
    1097. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001088 tRNA-Sec
    1098. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001089 tRNA-Sec
    1099. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001090 tRNA-Sec
    1100. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001099 tRNA-Sec
    1101. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001102 tRNA-Sec
    1102. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001105 tRNA-Sec
    1103. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001107 tRNA-Sec
    1104. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001108 tRNA-Sec
    1105. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001109 tRNA-Sec
    1106. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001111 tRNA-Sec
    1107. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001112 tRNA-Sec
    1108. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001114 tRNA-Sec
    1109. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001115 tRNA-Sec
    1110. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001117 tRNA-Sec
    1111. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001118 tRNA-Sec
    1112. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001140 tRNA-Sec
    1113. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001591 tRNA-Sec
    1114. Salmonella enterica subsp. enterica serovar Bareilly tRNA-Sec
    1115. Salmonella enterica subsp. enterica serovar Bargny tRNA-Sec
    1116. Salmonella enterica subsp. enterica serovar Barranquilla tRNA-Sec
    1117. Salmonella enterica subsp. enterica serovar Beaudesert tRNA-Sec
    1118. Salmonella enterica subsp. enterica serovar Benin tRNA-Sec
    1119. Salmonella enterica subsp. enterica serovar Bere tRNA-Sec
    1120. Salmonella enterica subsp. enterica serovar Bergen str. ST350 tRNA-Sec
    1121. Salmonella enterica subsp. enterica serovar Bergen tRNA-Sec
    1122. Salmonella enterica subsp. enterica serovar Berkeley tRNA-Sec
    1123. Salmonella enterica subsp. enterica serovar Berlin tRNA-Sec
    1124. Salmonella enterica subsp. enterica serovar Berta str. ATCC 8392 tRNA-Sec
    1125. Salmonella enterica subsp. enterica serovar Berta str. SA20103550 tRNA-Sec
    1126. Salmonella enterica subsp. enterica serovar Berta tRNA-Sec
    1127. Salmonella enterica subsp. enterica serovar Bietri tRNA-Sec
    1128. Salmonella enterica subsp. enterica serovar Bijlmer tRNA-Sec
    1129. Salmonella enterica subsp. enterica serovar Binza tRNA-Sec
    1130. Salmonella enterica subsp. enterica serovar Birkenhead tRNA-Sec
    1131. Salmonella enterica subsp. enterica serovar Bispebjerg tRNA-Sec
    1132. Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 tRNA-Sec
    1133. Salmonella enterica subsp. enterica serovar Blegdam tRNA-Sec
    1134. Salmonella enterica subsp. enterica serovar Blockley tRNA-Sec
    1135. Salmonella enterica subsp. enterica serovar Blukwa tRNA-Sec
    1136. Salmonella enterica subsp. enterica serovar Bochum tRNA-Sec
    1137. Salmonella enterica subsp. enterica serovar Bonariensis tRNA-Sec
    1138. Salmonella enterica subsp. enterica serovar Bonn tRNA-Sec
    1139. Salmonella enterica subsp. enterica serovar Borreze str. SA20041063 tRNA-Sec
    1140. Salmonella enterica subsp. enterica serovar Bovismorbificans str. 3114 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1141. Salmonella enterica subsp. enterica serovar Bovismorbificans str. Sal610 tRNA-Sec
    1142. Salmonella enterica subsp. enterica serovar Bovismorbificans tRNA-Sec
    1143. Salmonella enterica subsp. enterica serovar Bracknell tRNA-Sec
    1144. Salmonella enterica subsp. enterica serovar Braenderup str. ATCC BAA-664 tRNA-Sec
    1145. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN000756 tRNA-Sec
    1146. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN001745 tRNA-Sec
    1147. Salmonella enterica subsp. enterica serovar Braenderup tRNA-Sec
    1148. Salmonella enterica subsp. enterica serovar Brancaster tRNA-Sec
    1149. Salmonella enterica subsp. enterica serovar Brandenburg tRNA-Sec
    1150. Salmonella enterica subsp. enterica serovar Brazzaville tRNA-Sec
    1151. Salmonella enterica subsp. enterica serovar Breda tRNA-Sec
    1152. Salmonella enterica subsp. enterica serovar Bredeney str. CFSAN001080 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1153. Salmonella enterica subsp. enterica serovar Bredeney tRNA-Sec
    1154. Salmonella enterica subsp. enterica serovar Breukelen tRNA-Sec
    1155. Salmonella enterica subsp. enterica serovar Brevik tRNA-Sec
    1156. Salmonella enterica subsp. enterica serovar Brijbhumi tRNA-Sec
    1157. Salmonella enterica subsp. enterica serovar Bristol tRNA-Sec
    1158. Salmonella enterica subsp. enterica serovar Bron tRNA-Sec
    1159. Salmonella enterica subsp. enterica serovar Brunei tRNA-Sec
    1160. Salmonella enterica subsp. enterica serovar Buckeye tRNA-Sec
    1161. Salmonella enterica subsp. enterica serovar Bukavu tRNA-Sec
    1162. Salmonella enterica subsp. enterica serovar Butantan tRNA-Sec
    1163. Salmonella enterica subsp. enterica serovar Buzu tRNA-Sec
    1164. Salmonella enterica subsp. enterica serovar Cairina tRNA-Sec
    1165. Salmonella enterica subsp. enterica serovar Calabar tRNA-Sec
    1166. Salmonella enterica subsp. enterica serovar California tRNA-Sec
    1167. Salmonella enterica subsp. enterica serovar Canada tRNA-Sec
    1168. Salmonella enterica subsp. enterica serovar Cannstatt tRNA-Sec
    1169. Salmonella enterica subsp. enterica serovar Caracas tRNA-Sec
    1170. Salmonella enterica subsp. enterica serovar Cardoner tRNA-Sec
    1171. Salmonella enterica subsp. enterica serovar Carmel tRNA-Sec
    1172. Salmonella enterica subsp. enterica serovar Carno tRNA-Sec
    1173. Salmonella enterica subsp. enterica serovar Carrau tRNA-Sec
    1174. Salmonella enterica subsp. enterica serovar Cerro str. FSL R8-0235 tRNA-Sec
    1175. Salmonella enterica subsp. enterica serovar Cerro str. 5569 tRNA-Sec
    1176. Salmonella enterica subsp. enterica serovar Cerro str. 818 tRNA-Sec
    1177. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001587 tRNA-Sec
    1178. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 tRNA-Sec
    1179. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001589 tRNA-Sec
    1180. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001590 tRNA-Sec
    1181. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001669 tRNA-Sec
    1182. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001670 tRNA-Sec
    1183. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001671 tRNA-Sec
    1184. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001673 tRNA-Sec
    1185. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001674 tRNA-Sec
    1186. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001679 tRNA-Sec
    1187. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001680 tRNA-Sec
    1188. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001681 tRNA-Sec
    1189. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001690 tRNA-Sec
    1190. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001691 tRNA-Sec
    1191. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001692 tRNA-Sec
    1192. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001697 tRNA-Sec
    1193. Salmonella enterica subsp. enterica serovar Cerro tRNA-Sec
    1194. Salmonella enterica subsp. enterica serovar Ceyco tRNA-Sec
    1195. Salmonella enterica subsp. enterica serovar Chailey tRNA-Sec
    1196. Salmonella enterica subsp. enterica serovar Champaign tRNA-Sec
    1197. Salmonella enterica subsp. enterica serovar Chandans tRNA-Sec
    1198. Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 tRNA-Sec
    1199. Salmonella enterica subsp. enterica serovar Chester tRNA-Sec
    1200. Salmonella enterica subsp. enterica serovar Chicago tRNA-Sec
    1201. Salmonella enterica subsp. enterica serovar Chichester tRNA-Sec
    1202. Salmonella enterica subsp. enterica serovar Chincol tRNA-Sec
    1203. Salmonella enterica subsp. enterica serovar Chittagong tRNA-Sec
    1204. Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 tRNA-Sec
    1205. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000514 tRNA-Sec
    1206. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000515 tRNA-Sec
    1207. Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1208. Salmonella enterica subsp. enterica serovar Choleraesuis tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1209. Salmonella enterica subsp. enterica serovar Chomedey tRNA-Sec
    1210. Salmonella enterica subsp. enterica serovar Clackamas tRNA-Sec
    1211. Salmonella enterica subsp. enterica serovar Claibornei tRNA-Sec
    1212. Salmonella enterica subsp. enterica serovar Coeln tRNA-Sec
    1213. Salmonella enterica subsp. enterica serovar Coleypark tRNA-Sec
    1214. Salmonella enterica subsp. enterica serovar Colindale tRNA-Sec
    1215. Salmonella enterica subsp. enterica serovar Colorado tRNA-Sec
    1216. Salmonella enterica subsp. enterica serovar Concord tRNA-Sec
    1217. Salmonella enterica subsp. enterica serovar Copenhagen tRNA-Sec
    1218. Salmonella enterica subsp. enterica serovar Coquilhatville tRNA-Sec
    1219. Salmonella enterica subsp. enterica serovar Corvallis tRNA-Sec
    1220. Salmonella enterica subsp. enterica serovar Cotham tRNA-Sec
    1221. Salmonella enterica subsp. enterica serovar Cremieu tRNA-Sec
    1222. Salmonella enterica subsp. enterica serovar Crossness str. 1422-74 tRNA-Sec
    1223. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1224. Salmonella enterica subsp. enterica serovar Cubana str. CVM42234 tRNA-Sec
    1225. Salmonella enterica subsp. enterica serovar Cubana tRNA-Sec
    1226. Salmonella enterica subsp. enterica serovar Cullingworth tRNA-Sec
    1227. Salmonella enterica subsp. enterica serovar Curacao tRNA-Sec
    1228. Salmonella enterica subsp. enterica serovar Dabou tRNA-Sec
    1229. Salmonella enterica subsp. enterica serovar Daytona tRNA-Sec
    1230. Salmonella enterica subsp. enterica serovar Decatur tRNA-Sec
    1231. Salmonella enterica subsp. enterica serovar Denver tRNA-Sec
    1232. Salmonella enterica subsp. enterica serovar Derby str. 626 tRNA-Sec
    1233. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000564 tRNA-Sec
    1234. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000565 tRNA-Sec
    1235. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000566 tRNA-Sec
    1236. Salmonella enterica subsp. enterica serovar Derby tRNA-Sec
    1237. Salmonella enterica subsp. enterica serovar Dessau tRNA-Sec
    1238. Salmonella enterica subsp. enterica serovar Diguel tRNA-Sec
    1239. Salmonella enterica subsp. enterica serovar Djakarta str. S-1087 tRNA-Sec
    1240. Salmonella enterica subsp. enterica serovar Djugu tRNA-Sec
    1241. Salmonella enterica subsp. enterica serovar Dortmund tRNA-Sec
    1242. Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 tRNA-Sec
    1243. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000517 tRNA-Sec
    1244. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000518 tRNA-Sec
    1245. Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1246. Salmonella enterica subsp. enterica serovar Dublin str. SA20093032 tRNA-Sec
    1247. Salmonella enterica subsp. enterica serovar Dublin str. SL1438 tRNA-Sec
    1248. Salmonella enterica subsp. enterica serovar Dublin tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1249. Salmonella enterica subsp. enterica serovar Duesseldorf tRNA-Sec
    1250. Salmonella enterica subsp. enterica serovar Dugbe tRNA-Sec
    1251. Salmonella enterica subsp. enterica serovar Duisburg tRNA-Sec
    1252. Salmonella enterica subsp. enterica serovar Durban tRNA-Sec
    1253. Salmonella enterica subsp. enterica serovar Durham tRNA-Sec
    1254. Salmonella enterica subsp. enterica serovar Ealing tRNA-Sec
    1255. Salmonella enterica subsp. enterica serovar Eastbourne str. CFSAN001084 tRNA-Sec
    1256. Salmonella enterica subsp. enterica serovar Eastbourne tRNA-Sec
    1257. Salmonella enterica subsp. enterica serovar Eboko tRNA-Sec
    1258. Salmonella enterica subsp. enterica serovar Eingedi tRNA-Sec
    1259. Salmonella enterica subsp. enterica serovar Ekotedo tRNA-Sec
    1260. Salmonella enterica subsp. enterica serovar Eko tRNA-Sec
    1261. Salmonella enterica subsp. enterica serovar Ekpoui tRNA-Sec
    1262. Salmonella enterica subsp. enterica serovar Elisabethville tRNA-Sec
    1263. Salmonella enterica subsp. enterica serovar Elomrane tRNA-Sec
    1264. Salmonella enterica subsp. enterica serovar Emek tRNA-Sec
    1265. Salmonella enterica subsp. enterica serovar Enteritidis str. 10-34587 tRNA-Sec
    1266. Salmonella enterica subsp. enterica serovar Enteritidis str. 13183-1 tRNA-Sec
    1267. Salmonella enterica subsp. enterica serovar Enteritidis str. 13-1 tRNA-Sec
    1268. Salmonella enterica subsp. enterica serovar Enteritidis str. 17927 tRNA-Sec
    1269. Salmonella enterica subsp. enterica serovar Enteritidis str. 18569 tRNA-Sec
    1270. Salmonella enterica subsp. enterica serovar Enteritidis str. 20037 tRNA-Sec
    1271. Salmonella enterica subsp. enterica serovar Enteritidis str. 22510-1 tRNA-Sec
    1272. Salmonella enterica subsp. enterica serovar Enteritidis str. 22558 tRNA-Sec
    1273. Salmonella enterica subsp. enterica serovar Enteritidis str. 22704 tRNA-Sec
    1274. Salmonella enterica subsp. enterica serovar Enteritidis str. 33944 tRNA-Sec
    1275. Salmonella enterica subsp. enterica serovar Enteritidis str. 3402 tRNA-Sec
    1276. Salmonella enterica subsp. enterica serovar Enteritidis str. 436 tRNA-Sec
    1277. Salmonella enterica subsp. enterica serovar Enteritidis str. 485549-17 tRNA-Sec
    1278. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-3079 tRNA-Sec
    1279. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-5646 tRNA-Sec
    1280. Salmonella enterica subsp. enterica serovar Enteritidis str. 53-407 tRNA-Sec
    1281. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 22-17 tRNA-Sec
    1282. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 40-18 tRNA-Sec
    1283. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 42-20 tRNA-Sec
    1284. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 1-1 tRNA-Sec
    1285. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 9-7 tRNA-Sec
    1286. Salmonella enterica subsp. enterica serovar Enteritidis str. 576709 tRNA-Sec
    1287. Salmonella enterica subsp. enterica serovar Enteritidis str. 58-6482 tRNA-Sec
    1288. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-22 tRNA-Sec
    1289. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-70 tRNA-Sec
    1290. Salmonella enterica subsp. enterica serovar Enteritidis str. 6.0562-1 tRNA-Sec
    1291. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-2 tRNA-Sec
    1292. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-6 tRNA-Sec
    1293. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-16 tRNA-Sec
    1294. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-19 tRNA-Sec
    1295. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-9 tRNA-Sec
    1296. Salmonella enterica subsp. enterica serovar Enteritidis str. 62-1976 tRNA-Sec
    1297. Salmonella enterica subsp. enterica serovar Enteritidis str. 622731-39 tRNA-Sec
    1298. Salmonella enterica subsp. enterica serovar Enteritidis str. 629163 tRNA-Sec
    1299. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-26 tRNA-Sec
    1300. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-37 tRNA-Sec
    1301. Salmonella enterica subsp. enterica serovar Enteritidis str. 635290-58 tRNA-Sec
    1302. Salmonella enterica subsp. enterica serovar Enteritidis str. 638970-15 tRNA-Sec
    1303. Salmonella enterica subsp. enterica serovar Enteritidis str. 639016-6 tRNA-Sec
    1304. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-46 tRNA-Sec
    1305. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-50 tRNA-Sec
    1306. Salmonella enterica subsp. enterica serovar Enteritidis str. 640631 tRNA-Sec
    1307. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 4-1 tRNA-Sec
    1308. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 8-1 tRNA-Sec
    1309. Salmonella enterica subsp. enterica serovar Enteritidis str. 642046 4-7 tRNA-Sec
    1310. Salmonella enterica subsp. enterica serovar Enteritidis str. 648898 4-5 tRNA-Sec
    1311. Salmonella enterica subsp. enterica serovar Enteritidis str. 648899 3-17 tRNA-Sec
    1312. Salmonella enterica subsp. enterica serovar Enteritidis str. 648900 1-16 tRNA-Sec
    1313. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 1-17 tRNA-Sec
    1314. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 16-16 tRNA-Sec
    1315. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 39-2 tRNA-Sec
    1316. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 6-18 tRNA-Sec
    1317. Salmonella enterica subsp. enterica serovar Enteritidis str. 648902 6-8 tRNA-Sec
    1318. Salmonella enterica subsp. enterica serovar Enteritidis str. 648903 1-6 tRNA-Sec
    1319. Salmonella enterica subsp. enterica serovar Enteritidis str. 648904 3-6 tRNA-Sec
    1320. Salmonella enterica subsp. enterica serovar Enteritidis str. 648905 5-18 tRNA-Sec
    1321. Salmonella enterica subsp. enterica serovar Enteritidis str. 653049 13-19 tRNA-Sec
    1322. Salmonella enterica subsp. enterica serovar Enteritidis str. 76-2651 tRNA-Sec
    1323. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-0424 tRNA-Sec
    1324. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1325. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-2659 tRNA-Sec
    1326. Salmonella enterica subsp. enterica serovar Enteritidis str. 78-1757 tRNA-Sec
    1327. Salmonella enterica subsp. enterica serovar Enteritidis str. 81-2625 tRNA-Sec
    1328. Salmonella enterica subsp. enterica serovar Enteritidis str. 8b-1 tRNA-Sec
    1329. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0895 tRNA-Sec
    1330. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0899 tRNA-Sec
    1331. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0956 tRNA-Sec
    1332. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1333. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1010 tRNA-Sec
    1334. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1018 tRNA-Sec
    1335. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1441 tRNA-Sec
    1336. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1444 tRNA-Sec
    1337. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1445 tRNA-Sec
    1338. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1455 tRNA-Sec
    1339. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1457 tRNA-Sec
    1340. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1543 tRNA-Sec
    1341. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1558 tRNA-Sec
    1342. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1559 tRNA-Sec
    1343. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1565 tRNA-Sec
    1344. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1566 tRNA-Sec
    1345. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1575 tRNA-Sec
    1346. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1580 tRNA-Sec
    1347. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1594 tRNA-Sec
    1348. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1725 tRNA-Sec
    1349. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1729 tRNA-Sec
    1350. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1745 tRNA-Sec
    1351. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1747 tRNA-Sec
    1352. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1791 tRNA-Sec
    1353. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1795 tRNA-Sec
    1354. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1808 tRNA-Sec
    1355. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1810 tRNA-Sec
    1356. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1811 tRNA-Sec
    1357. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1882 tRNA-Sec
    1358. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1884 tRNA-Sec
    1359. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000052 tRNA-Sec
    1360. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000568 tRNA-Sec
    1361. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS44 tRNA-Sec
    1362. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS4 tRNA-Sec
    1363. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_56-3991 tRNA-Sec
    1364. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_69-4941 tRNA-Sec
    1365. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_76-3618 tRNA-Sec
    1366. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_81-2490 tRNA-Sec
    1367. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_N202 tRNA-Sec
    1368. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090135 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1369. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090193 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1370. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090195 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1371. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090332 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1372. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090530 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1373. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090531 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1374. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090641 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1375. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090698 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1376. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090884 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1377. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100088 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1378. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100089 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1379. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100100 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1380. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100101 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1381. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100103 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1382. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100130 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1383. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100131 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1384. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100134 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1385. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100325 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1386. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110221 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1387. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110222 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1388. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110223 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1389. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110353 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1390. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110354 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1391. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110355 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1392. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110356 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1393. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110357 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1394. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110358 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1395. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110359 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1396. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110360 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1397. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110361 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1398. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111095 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1399. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111174 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1400. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111175 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1401. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111510 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1402. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111514 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1403. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111515 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1404. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111554 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1405. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111561 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1406. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111576 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1407. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120002 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1408. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120003 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1409. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120005 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1410. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120007 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1411. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120008 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1412. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120009 tRNA-Sec
    1413. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120051 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1414. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120200 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1415. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120213 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1416. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120219 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1417. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120229 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1418. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120240 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1419. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120356 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1420. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120469 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1421. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120496 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1422. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120497 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1423. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120498 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1424. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120505 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1425. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120528 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1426. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120544 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1427. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120548 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1428. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120555 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1429. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120580 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1430. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120581 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1431. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120590 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1432. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120597 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1433. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120677 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1434. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120685 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1435. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120686 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1436. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120687 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1437. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120697 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1438. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120722 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1439. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120734 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1440. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120738 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1441. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120765 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1442. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120773 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1443. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120774 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1444. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120775 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1445. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120776 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1446. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120916 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1447. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120917 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1448. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120918 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1449. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120925 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1450. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120927 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1451. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120929 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1452. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120963 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1453. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120968 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1454. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120969 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1455. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120970 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1456. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120994 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1457. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121004 tRNA-Sec
    1458. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121175 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1459. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121176 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1460. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121177 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1461. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121178 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1462. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121179 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1463. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121180 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1464. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121541 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1465. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121542 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1466. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121671 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1467. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121672 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1468. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121689 tRNA-Sec
    1469. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121744 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1470. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121746 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1471. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121747 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1472. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121748 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1473. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121750 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1474. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121751 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1475. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121753 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1476. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121765 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1477. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121812 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1478. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121825 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1479. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121826 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1480. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121969 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1481. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121970 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1482. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121976 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1483. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121986 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1484. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121989 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1485. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121990 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1486. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122022 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1487. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122026 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1488. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122031 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1489. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122033 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1490. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122045 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1491. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130345 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1492. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130346 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1493. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130347 tRNA-Sec
    1494. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130348 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1495. Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1496. Salmonella enterica subsp. enterica serovar Enteritidis str. PT23 tRNA-Sec
    1497. Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 tRNA-Sec
    1498. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19930684 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1499. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19940857 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1500. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19942384 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1501. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19943269 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1502. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19960848 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1503. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19961622 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1504. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970510 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1505. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970769 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1506. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19971331 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1507. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19980677 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1508. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981522 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1509. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981857 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1510. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19982831 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1511. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19983126 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1512. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19992322 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1513. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19994216 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1514. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20082034 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1515. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083456 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1516. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083636 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1517. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084384 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1518. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084644 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1519. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084824 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1520. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20085285 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1521. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090419 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1522. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090435 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1523. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090877 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1524. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20091739 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1525. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20092320 tRNA-Sec
    1526. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093266 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1527. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093421 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1528. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093430 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1529. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093538 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1530. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093543 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1531. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093784 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1532. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093788 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1533. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093950 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1534. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093977 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1535. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094079 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1536. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094177 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1537. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094301 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1538. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094350 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1539. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094352 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1540. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094383 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1541. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094389 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1542. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094521 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1543. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094642 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1544. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094682 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1545. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094803 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1546. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095309 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1547. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095440 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1548. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100239 tRNA-Sec
    1549. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100349 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1550. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20121703 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1551. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20123395 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1552. Salmonella enterica subsp. enterica serovar Enteritidis str. SARB17 tRNA-Sec
    1553. Salmonella enterica subsp. enterica serovar Enteritidis str. SE10 tRNA-Sec
    1554. Salmonella enterica subsp. enterica serovar Enteritidis str. SE15-1 tRNA-Sec
    1555. Salmonella enterica subsp. enterica serovar Enteritidis str. SE30663 tRNA-Sec
    1556. Salmonella enterica subsp. enterica serovar Enteritidis str. SE8a tRNA-Sec
    1557. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE001 tRNA-Sec
    1558. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE002 tRNA-Sec
    1559. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE003 tRNA-Sec
    1560. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE004 tRNA-Sec
    1561. Salmonella enterica subsp. enterica serovar Enteritidis str. SL909 tRNA-Sec
    1562. Salmonella enterica subsp. enterica serovar Enteritidis str. SL913 tRNA-Sec
    1563. Salmonella enterica subsp. enterica serovar Enteritidis tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1564. Salmonella enterica subsp. enterica serovar Enugu tRNA-Sec
    1565. Salmonella enterica subsp. enterica serovar Eschberg tRNA-Sec
    1566. Salmonella enterica subsp. enterica serovar Essen tRNA-Sec
    1567. Salmonella enterica subsp. enterica serovar Everleigh tRNA-Sec
    1568. Salmonella enterica subsp. enterica serovar Falkensee tRNA-Sec
    1569. Salmonella enterica subsp. enterica serovar Fallowfield tRNA-Sec
    1570. Salmonella enterica subsp. enterica serovar Fann tRNA-Sec
    1571. Salmonella enterica subsp. enterica serovar Fanti tRNA-Sec
    1572. Salmonella enterica subsp. enterica serovar Farmsen tRNA-Sec
    1573. Salmonella enterica subsp. enterica serovar Florian tRNA-Sec
    1574. Salmonella enterica subsp. enterica serovar Florida tRNA-Sec
    1575. Salmonella enterica subsp. enterica serovar Flottbek tRNA-Sec
    1576. Salmonella enterica subsp. enterica serovar Fluntern tRNA-Sec
    1577. Salmonella enterica subsp. enterica serovar Freetown tRNA-Sec
    1578. Salmonella enterica subsp. enterica serovar Fresno str. ST224 tRNA-Sec
    1579. Salmonella enterica subsp. enterica serovar Fresno tRNA-Sec
    1580. Salmonella enterica subsp. enterica serovar Fufu tRNA-Sec
    1581. Salmonella enterica subsp. enterica serovar Fulica tRNA-Sec
    1582. Salmonella enterica subsp. enterica serovar Gafsa tRNA-Sec
    1583. Salmonella enterica subsp. enterica serovar Galiema tRNA-Sec
    1584. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. CDC1983-67 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1585. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. FCAV198 tRNA-Sec
    1586. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. RKS5078 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1587. Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1588. Salmonella enterica subsp. enterica serovar Gallinarum str. 9184 tRNA-Sec
    1589. Salmonella enterica subsp. enterica serovar Gallinarum str. CFSAN000571 tRNA-Sec
    1590. Salmonella enterica subsp. enterica serovar Gallinarum tRNA-Sec
    1591. Salmonella enterica subsp. enterica serovar Gambia tRNA-Sec
    1592. Salmonella enterica subsp. enterica serovar Gaminara str. ATCC BAA-711 tRNA-Sec
    1593. Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 tRNA-Sec
    1594. Salmonella enterica subsp. enterica serovar Gaminara tRNA-Sec
    1595. Salmonella enterica subsp. enterica serovar Garoli tRNA-Sec
    1596. Salmonella enterica subsp. enterica serovar Gatow tRNA-Sec
    1597. Salmonella enterica subsp. enterica serovar Gatuni tRNA-Sec
    1598. Salmonella enterica subsp. enterica serovar Gdansk tRNA-Sec
    1599. Salmonella enterica subsp. enterica serovar Georgia tRNA-Sec
    1600. Salmonella enterica subsp. enterica serovar Geraldton tRNA-Sec
    1601. Salmonella enterica subsp. enterica serovar Giessen tRNA-Sec
    1602. Salmonella enterica subsp. enterica serovar Give tRNA-Sec
    1603. Salmonella enterica subsp. enterica serovar Give var. 15 str. CFSAN004343 tRNA-Sec
    1604. Salmonella enterica subsp. enterica serovar Glostrup tRNA-Sec
    1605. Salmonella enterica subsp. enterica serovar Gloucester tRNA-Sec
    1606. Salmonella enterica subsp. enterica serovar Godesberg tRNA-Sec
    1607. Salmonella enterica subsp. enterica serovar Gokul tRNA-Sec
    1608. Salmonella enterica subsp. enterica serovar Goldcoast tRNA-Sec
    1609. Salmonella enterica subsp. enterica serovar Gombe tRNA-Sec
    1610. Salmonella enterica subsp. enterica serovar Goverdhan tRNA-Sec
    1611. Salmonella enterica subsp. enterica serovar Grumpensis tRNA-Sec
    1612. Salmonella enterica subsp. enterica serovar Gueuletapee tRNA-Sec
    1613. Salmonella enterica subsp. enterica serovar Guildford tRNA-Sec
    1614. Salmonella enterica subsp. enterica serovar Guinea tRNA-Sec
    1615. Salmonella enterica subsp. enterica serovar Haardt tRNA-Sec
    1616. Salmonella enterica subsp. enterica serovar Hadar str. RI_05P066 tRNA-Sec
    1617. Salmonella enterica subsp. enterica serovar Hadar str. SA20026260 tRNA-Sec
    1618. Salmonella enterica subsp. enterica serovar Hadar tRNA-Sec
    1619. Salmonella enterica subsp. enterica serovar Haduna tRNA-Sec
    1620. Salmonella enterica subsp. enterica serovar Haga tRNA-Sec
    1621. Salmonella enterica subsp. enterica serovar Haifa tRNA-Sec
    1622. Salmonella enterica subsp. enterica serovar Halle tRNA-Sec
    1623. Salmonella enterica subsp. enterica serovar Hartford str. CFSAN001075 tRNA-Sec
    1624. Salmonella enterica subsp. enterica serovar Hartford tRNA-Sec
    1625. Salmonella enterica subsp. enterica serovar Hato tRNA-Sec
    1626. Salmonella enterica subsp. enterica serovar Havana tRNA-Sec
    1627. Salmonella enterica subsp. enterica serovar Hayindogo tRNA-Sec
    1628. Salmonella enterica subsp. enterica serovar Heidelberg str. 21381 tRNA-Sec
    1629. Salmonella enterica subsp. enterica serovar Heidelberg str. 24390 tRNA-Sec
    1630. Salmonella enterica subsp. enterica serovar Heidelberg str. 24393 tRNA-Sec
    1631. Salmonella enterica subsp. enterica serovar Heidelberg str. 29169 tRNA-Sec
    1632. Salmonella enterica subsp. enterica serovar Heidelberg str. 32507 tRNA-Sec
    1633. Salmonella enterica subsp. enterica serovar Heidelberg str. 41563 tRNA-Sec
    1634. Salmonella enterica subsp. enterica serovar Heidelberg str. 41565 tRNA-Sec
    1635. Salmonella enterica subsp. enterica serovar Heidelberg str. 41566 tRNA-Sec
    1636. Salmonella enterica subsp. enterica serovar Heidelberg str. 41567 tRNA-Sec
    1637. Salmonella enterica subsp. enterica serovar Heidelberg str. 41573 tRNA-Sec
    1638. Salmonella enterica subsp. enterica serovar Heidelberg str. 41576 tRNA-Sec
    1639. Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1640. Salmonella enterica subsp. enterica serovar Heidelberg str. 41579 tRNA-Sec
    1641. Salmonella enterica subsp. enterica serovar Heidelberg str. 41584 tRNA-Sec
    1642. Salmonella enterica subsp. enterica serovar Heidelberg str. 579082-8 tRNA-Sec
    1643. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-10 tRNA-Sec
    1644. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-19 tRNA-Sec
    1645. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-34 tRNA-Sec
    1646. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-5 tRNA-Sec
    1647. Salmonella enterica subsp. enterica serovar Heidelberg str. 607310-1 tRNA-Sec
    1648. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-11 tRNA-Sec
    1649. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-12 tRNA-Sec
    1650. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-14 tRNA-Sec
    1651. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-21 tRNA-Sec
    1652. Salmonella enterica subsp. enterica serovar Heidelberg str. 632675-24 tRNA-Sec
    1653. Salmonella enterica subsp. enterica serovar Heidelberg str. 640151-11 tRNA-Sec
    1654. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-3 tRNA-Sec
    1655. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-5 tRNA-Sec
    1656. Salmonella enterica subsp. enterica serovar Heidelberg str. 75-3547 tRNA-Sec
    1657. Salmonella enterica subsp. enterica serovar Heidelberg str. 76-0300 tRNA-Sec
    1658. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-1831 tRNA-Sec
    1659. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-2823 tRNA-Sec
    1660. Salmonella enterica subsp. enterica serovar Heidelberg str. 79-0480 tRNA-Sec
    1661. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-1617 tRNA-Sec
    1662. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-2052 tRNA-Sec
    1663. Salmonella enterica subsp. enterica serovar Heidelberg str. 83-1068 tRNA-Sec
    1664. Salmonella enterica subsp. enterica serovar Heidelberg str. 84-1004 tRNA-Sec
    1665. Salmonella enterica subsp. enterica serovar Heidelberg str. 85-0486 tRNA-Sec
    1666. Salmonella enterica subsp. enterica serovar Heidelberg str. 86-0255 tRNA-Sec
    1667. Salmonella enterica subsp. enterica serovar Heidelberg str. 87-0208 tRNA-Sec
    1668. Salmonella enterica subsp. enterica serovar Heidelberg str. 88-0312 tRNA-Sec
    1669. Salmonella enterica subsp. enterica serovar Heidelberg str. 89-0213 tRNA-Sec
    1670. Salmonella enterica subsp. enterica serovar Heidelberg str. 90-0318 tRNA-Sec
    1671. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0138 tRNA-Sec
    1672. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0144 tRNA-Sec
    1673. Salmonella enterica subsp. enterica serovar Heidelberg str. B182 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1674. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000577 tRNA-Sec
    1675. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000578 tRNA-Sec
    1676. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001902 tRNA-Sec
    1677. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001914 tRNA-Sec
    1678. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002056 tRNA-Sec
    1679. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002057 tRNA-Sec
    1680. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002058 tRNA-Sec
    1681. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002059 tRNA-Sec
    1682. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002060 tRNA-Sec
    1683. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002061 tRNA-Sec
    1684. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002062 tRNA-Sec
    1685. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002063 tRNA-Sec
    1686. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1687. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002065 tRNA-Sec
    1688. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002066 tRNA-Sec
    1689. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002067 tRNA-Sec
    1690. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002068 tRNA-Sec
    1691. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1692. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002071 tRNA-Sec
    1693. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002072 tRNA-Sec
    1694. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002073 tRNA-Sec
    1695. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002074 tRNA-Sec
    1696. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002075 tRNA-Sec
    1697. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00322 tRNA-Sec
    1698. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00323 tRNA-Sec
    1699. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00324 tRNA-Sec
    1700. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00325 tRNA-Sec
    1701. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00326 tRNA-Sec
    1702. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00327 tRNA-Sec
    1703. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00328 tRNA-Sec
    1704. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003463 tRNA-Sec
    1705. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003467 tRNA-Sec
    1706. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003468 tRNA-Sec
    1707. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003469 tRNA-Sec
    1708. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003472 tRNA-Sec
    1709. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003475 tRNA-Sec
    1710. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003480 tRNA-Sec
    1711. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003482 tRNA-Sec
    1712. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003484 tRNA-Sec
    1713. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003485 tRNA-Sec
    1714. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24359 tRNA-Sec
    1715. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24388 tRNA-Sec
    1716. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24391 tRNA-Sec
    1717. Salmonella enterica subsp. enterica serovar Heidelberg str. N1514 tRNA-Sec
    1718. Salmonella enterica subsp. enterica serovar Heidelberg str. N1536 tRNA-Sec
    1719. Salmonella enterica subsp. enterica serovar Heidelberg str. N15757 tRNA-Sec
    1720. Salmonella enterica subsp. enterica serovar Heidelberg str. N18393 tRNA-Sec
    1721. Salmonella enterica subsp. enterica serovar Heidelberg str. N18413 tRNA-Sec
    1722. Salmonella enterica subsp. enterica serovar Heidelberg str. N18440 tRNA-Sec
    1723. Salmonella enterica subsp. enterica serovar Heidelberg str. N18453 tRNA-Sec
    1724. Salmonella enterica subsp. enterica serovar Heidelberg str. N189 tRNA-Sec
    1725. Salmonella enterica subsp. enterica serovar Heidelberg str. N19871 tRNA-Sec
    1726. Salmonella enterica subsp. enterica serovar Heidelberg str. N19992 tRNA-Sec
    1727. Salmonella enterica subsp. enterica serovar Heidelberg str. N20134 tRNA-Sec
    1728. Salmonella enterica subsp. enterica serovar Heidelberg str. N26457 tRNA-Sec
    1729. Salmonella enterica subsp. enterica serovar Heidelberg str. N29341 tRNA-Sec
    1730. Salmonella enterica subsp. enterica serovar Heidelberg str. N30678 tRNA-Sec
    1731. Salmonella enterica subsp. enterica serovar Heidelberg str. N418 tRNA-Sec
    1732. Salmonella enterica subsp. enterica serovar Heidelberg str. N4403 tRNA-Sec
    1733. Salmonella enterica subsp. enterica serovar Heidelberg str. N4496 tRNA-Sec
    1734. Salmonella enterica subsp. enterica serovar Heidelberg str. N4541 tRNA-Sec
    1735. Salmonella enterica subsp. enterica serovar Heidelberg str. N4630 tRNA-Sec
    1736. Salmonella enterica subsp. enterica serovar Heidelberg str. N653 tRNA-Sec
    1737. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013193 tRNA-Sec
    1738. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013312 tRNA-Sec
    1739. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013343 tRNA-Sec
    1740. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013374 tRNA-Sec
    1741. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013988 tRNA-Sec
    1742. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014316 tRNA-Sec
    1743. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014319 tRNA-Sec
    1744. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014588 tRNA-Sec
    1745. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA31 tRNA-Sec
    1746. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA32 tRNA-Sec
    1747. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA33 tRNA-Sec
    1748. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 tRNA-Sec
    1749. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA36 tRNA-Sec
    1750. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA37 tRNA-Sec
    1751. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA 39 tRNA-Sec
    1752. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA40 tRNA-Sec
    1753. Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1754. Salmonella enterica subsp. enterica serovar Heidelberg str. SL486 tRNA-Sec
    1755. Salmonella enterica subsp. enterica serovar Heidelberg tRNA-Sec
    1756. Salmonella enterica subsp. enterica serovar Herston tRNA-Sec
    1757. Salmonella enterica subsp. enterica serovar Hessarek tRNA-Sec
    1758. Salmonella enterica subsp. enterica serovar Hillingdon str. N1529-D3 tRNA-Sec
    1759. Salmonella enterica subsp. enterica serovar Hillingdon tRNA-Sec
    1760. Salmonella enterica subsp. enterica serovar Hindmarsh tRNA-Sec
    1761. Salmonella enterica subsp. enterica serovar Hissar tRNA-Sec
    1762. Salmonella enterica subsp. enterica serovar Holcomb tRNA-Sec
    1763. Salmonella enterica subsp. enterica serovar Horsham tRNA-Sec
    1764. Salmonella enterica subsp. enterica serovar Houston tRNA-Sec
    1765. Salmonella enterica subsp. enterica serovar Hull tRNA-Sec
    1766. Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 tRNA-Sec
    1767. Salmonella enterica subsp. enterica serovar Hvittingfoss tRNA-Sec
    1768. Salmonella enterica subsp. enterica serovar Ibadan tRNA-Sec
    1769. Salmonella enterica subsp. enterica serovar Idikan tRNA-Sec
    1770. Salmonella enterica subsp. enterica serovar Ilala tRNA-Sec
    1771. Salmonella enterica subsp. enterica serovar Indiana str. ATCC 51959 tRNA-Sec
    1772. Salmonella enterica subsp. enterica serovar Indiana tRNA-Sec
    1773. Salmonella enterica subsp. enterica serovar India str. SA20085604 tRNA-Sec
    1774. Salmonella enterica subsp. enterica serovar Infantis str. 335-3 tRNA-Sec
    1775. Salmonella enterica subsp. enterica serovar Infantis str. CFSAN000522 tRNA-Sec
    1776. Salmonella enterica subsp. enterica serovar Infantis str. CVM 17958 tRNA-Sec
    1777. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22577 tRNA-Sec
    1778. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22582 tRNA-Sec
    1779. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23697 tRNA-Sec
    1780. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23729 tRNA-Sec
    1781. Salmonella enterica subsp. enterica serovar Infantis str. CVM 818 tRNA-Sec
    1782. Salmonella enterica subsp. enterica serovar Infantis str. CVM N13139 tRNA-Sec
    1783. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15228 tRNA-Sec
    1784. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15773 tRNA-Sec
    1785. Salmonella enterica subsp. enterica serovar Infantis str. CVM N19983 tRNA-Sec
    1786. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20078 tRNA-Sec
    1787. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20272 tRNA-Sec
    1788. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23532 tRNA-Sec
    1789. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23771 tRNA-Sec
    1790. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23791 tRNA-Sec
    1791. Salmonella enterica subsp. enterica serovar Infantis str. CVM N26093 tRNA-Sec
    1792. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29304 tRNA-Sec
    1793. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29379 tRNA-Sec
    1794. Salmonella enterica subsp. enterica serovar Infantis str. CVM N31594 tRNA-Sec
    1795. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32590PS tRNA-Sec
    1796. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32597PS tRNA-Sec
    1797. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32599PS tRNA-Sec
    1798. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32760 tRNA-Sec
    1799. Salmonella enterica subsp. enterica serovar Infantis str. CVM N34868PS tRNA-Sec
    1800. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35495PS tRNA-Sec
    1801. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35518 tRNA-Sec
    1802. Salmonella enterica subsp. enterica serovar Infantis str. CVM N38848 tRNA-Sec
    1803. Salmonella enterica subsp. enterica serovar Infantis str. CVM N41903 tRNA-Sec
    1804. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42236 tRNA-Sec
    1805. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42459 tRNA-Sec
    1806. Salmonella enterica subsp. enterica serovar Infantis tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1807. Salmonella enterica subsp. enterica serovar Inganda tRNA-Sec
    1808. Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 tRNA-Sec
    1809. Salmonella enterica subsp. enterica serovar Inverness tRNA-Sec
    1810. Salmonella enterica subsp. enterica serovar Irumu tRNA-Sec
    1811. Salmonella enterica subsp. enterica serovar Isangi tRNA-Sec
    1812. Salmonella enterica subsp. enterica serovar Istanbul tRNA-Sec
    1813. Salmonella enterica subsp. enterica serovar Itami str. SA20014991 tRNA-Sec
    1814. Salmonella enterica subsp. enterica serovar Itami tRNA-Sec
    1815. Salmonella enterica subsp. enterica serovar Ituri tRNA-Sec
    1816. Salmonella enterica subsp. enterica serovar Jangwani tRNA-Sec
    1817. Salmonella enterica subsp. enterica serovar Java tRNA-Sec
    1818. Salmonella enterica subsp. enterica serovar Javiana str. 10721 tRNA-Sec
    1819. Salmonella enterica subsp. enterica serovar Javiana str. ATCC BAA-1593 tRNA-Sec
    1820. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000904 tRNA-Sec
    1821. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000905 tRNA-Sec
    1822. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN001992 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1823. Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433 tRNA-Sec
    1824. Salmonella enterica subsp. enterica serovar Javiana str. PRS_2010_0720 tRNA-Sec
    1825. Salmonella enterica subsp. enterica serovar Javiana tRNA-Sec
    1826. Salmonella enterica subsp. enterica serovar Jerusalem tRNA-Sec
    1827. Salmonella enterica subsp. enterica serovar Joal tRNA-Sec
    1828. Salmonella enterica subsp. enterica serovar Jodhpur tRNA-Sec
    1829. Salmonella enterica subsp. enterica serovar Johannesburg str. SA20025782 tRNA-Sec
    1830. Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 tRNA-Sec
    1831. Salmonella enterica subsp. enterica serovar Johannesburg tRNA-Sec
    1832. Salmonella enterica subsp. enterica serovar Jubilee tRNA-Sec
    1833. Salmonella enterica subsp. enterica serovar Jukestown tRNA-Sec
    1834. Salmonella enterica subsp. enterica serovar Kaapstad tRNA-Sec
    1835. Salmonella enterica subsp. enterica serovar Kalamu tRNA-Sec
    1836. Salmonella enterica subsp. enterica serovar Kallo tRNA-Sec
    1837. Salmonella enterica subsp. enterica serovar Kambole tRNA-Sec
    1838. Salmonella enterica subsp. enterica serovar Kande tRNA-Sec
    1839. Salmonella enterica subsp. enterica serovar Kaolack tRNA-Sec
    1840. Salmonella enterica subsp. enterica serovar Kapemba tRNA-Sec
    1841. Salmonella enterica subsp. enterica serovar Karamoja tRNA-Sec
    1842. Salmonella enterica subsp. enterica serovar Kasenyi tRNA-Sec
    1843. Salmonella enterica subsp. enterica serovar Kastrup tRNA-Sec
    1844. Salmonella enterica subsp. enterica serovar Kedougou tRNA-Sec
    1845. Salmonella enterica subsp. enterica serovar Kentucky str. 13562 tRNA-Sec
    1846. Salmonella enterica subsp. enterica serovar Kentucky str. 20793 tRNA-Sec
    1847. Salmonella enterica subsp. enterica serovar Kentucky str. 22694 tRNA-Sec
    1848. Salmonella enterica subsp. enterica serovar Kentucky str. 29166 tRNA-Sec
    1849. Salmonella enterica subsp. enterica serovar Kentucky str. CDC 191 tRNA-Sec
    1850. Salmonella enterica subsp. enterica serovar Kentucky str. CVM29188 tRNA-Sec
    1851. Salmonella enterica subsp. enterica serovar Kentucky str. N312 tRNA-Sec
    1852. Salmonella enterica subsp. enterica serovar Kentucky str. SA20030505 tRNA-Sec
    1853. Salmonella enterica subsp. enterica serovar Kentucky tRNA-Sec
    1854. Salmonella enterica subsp. enterica serovar Kenya tRNA-Sec
    1855. Salmonella enterica subsp. enterica serovar Kiambu tRNA-Sec
    1856. Salmonella enterica subsp. enterica serovar Kibi tRNA-Sec
    1857. Salmonella enterica subsp. enterica serovar Kibusi tRNA-Sec
    1858. Salmonella enterica subsp. enterica serovar Kimberley tRNA-Sec
    1859. Salmonella enterica subsp. enterica serovar Kimuenza tRNA-Sec
    1860. Salmonella enterica subsp. enterica serovar Kingabwa tRNA-Sec
    1861. Salmonella enterica subsp. enterica serovar Kingston tRNA-Sec
    1862. Salmonella enterica subsp. enterica serovar Kinondoni tRNA-Sec
    1863. Salmonella enterica subsp. enterica serovar Kinshasa tRNA-Sec
    1864. Salmonella enterica subsp. enterica serovar Kintambo tRNA-Sec
    1865. Salmonella enterica subsp. enterica serovar Kirkee tRNA-Sec
    1866. Salmonella enterica subsp. enterica serovar Kisangani tRNA-Sec
    1867. Salmonella enterica subsp. enterica serovar Kisarawe tRNA-Sec
    1868. Salmonella enterica subsp. enterica serovar Kisii tRNA-Sec
    1869. Salmonella enterica subsp. enterica serovar Koessen str. S-1501 tRNA-Sec
    1870. Salmonella enterica subsp. enterica serovar Koketime tRNA-Sec
    1871. Salmonella enterica subsp. enterica serovar Kokomlemle tRNA-Sec
    1872. Salmonella enterica subsp. enterica serovar Kottbus tRNA-Sec
    1873. Salmonella enterica subsp. enterica serovar Kouka tRNA-Sec
    1874. Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 tRNA-Sec
    1875. Salmonella enterica subsp. enterica serovar Krefeld tRNA-Sec
    1876. Salmonella enterica subsp. enterica serovar Kua tRNA-Sec
    1877. Salmonella enterica subsp. enterica serovar Kuessel tRNA-Sec
    1878. Salmonella enterica subsp. enterica serovar Kumasi tRNA-Sec
    1879. Salmonella enterica subsp. enterica serovar Kunzendorf tRNA-Sec
    1880. Salmonella enterica subsp. enterica serovar Lagos tRNA-Sec
    1881. Salmonella enterica subsp. enterica serovar Lanka tRNA-Sec
    1882. Salmonella enterica subsp. enterica serovar Lansing tRNA-Sec
    1883. Salmonella enterica subsp. enterica serovar Larochelle tRNA-Sec
    1884. Salmonella enterica subsp. enterica serovar Lattenkamp tRNA-Sec
    1885. Salmonella enterica subsp. enterica serovar Lawndale tRNA-Sec
    1886. Salmonella enterica subsp. enterica serovar Leatherhead tRNA-Sec
    1887. Salmonella enterica subsp. enterica serovar Leeuwarden tRNA-Sec
    1888. Salmonella enterica subsp. enterica serovar Legon tRNA-Sec
    1889. Salmonella enterica subsp. enterica serovar Leoben tRNA-Sec
    1890. Salmonella enterica subsp. enterica serovar Lerum tRNA-Sec
    1891. Salmonella enterica subsp. enterica serovar Lexington tRNA-Sec
    1892. Salmonella enterica subsp. enterica serovar Lexington var. 15+ tRNA-Sec
    1893. Salmonella enterica subsp. enterica serovar Lika tRNA-Sec
    1894. Salmonella enterica subsp. enterica serovar Lille tRNA-Sec
    1895. Salmonella enterica subsp. enterica serovar Limete tRNA-Sec
    1896. Salmonella enterica subsp. enterica serovar Lindern tRNA-Sec
    1897. Salmonella enterica subsp. enterica serovar Linton tRNA-Sec
    1898. Salmonella enterica subsp. enterica serovar Litchfield tRNA-Sec
    1899. Salmonella enterica subsp. enterica serovar Liverpool tRNA-Sec
    1900. Salmonella enterica subsp. enterica serovar Livingstone tRNA-Sec
    1901. Salmonella enterica subsp. enterica serovar Llandoff tRNA-Sec
    1902. Salmonella enterica subsp. enterica serovar Loanda tRNA-Sec
    1903. Salmonella enterica subsp. enterica serovar Lomalinda tRNA-Sec
    1904. Salmonella enterica subsp. enterica serovar Lome tRNA-Sec
    1905. Salmonella enterica subsp. enterica serovar London tRNA-Sec
    1906. Salmonella enterica subsp. enterica serovar Louisiana tRNA-Sec
    1907. Salmonella enterica subsp. enterica serovar Lubbock tRNA-Sec
    1908. Salmonella enterica subsp. enterica serovar Luciana tRNA-Sec
    1909. Salmonella enterica subsp. enterica serovar Luke tRNA-Sec
    1910. Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 tRNA-Sec
    1911. Salmonella enterica subsp. enterica serovar Madelia tRNA-Sec
    1912. Salmonella enterica subsp. enterica serovar Malaysia tRNA-Sec
    1913. Salmonella enterica subsp. enterica serovar Malstatt tRNA-Sec
    1914. Salmonella enterica subsp. enterica serovar Manchester str. ST278 tRNA-Sec
    1915. Salmonella enterica subsp. enterica serovar Manchester tRNA-Sec
    1916. Salmonella enterica subsp. enterica serovar Manhattan str. SA20034532 tRNA-Sec
    1917. Salmonella enterica subsp. enterica serovar Manhattan tRNA-Sec
    1918. Salmonella enterica subsp. enterica serovar Mapo tRNA-Sec
    1919. Salmonella enterica subsp. enterica serovar Maracaibo tRNA-Sec
    1920. Salmonella enterica subsp. enterica serovar Matadi tRNA-Sec
    1921. Salmonella enterica subsp. enterica serovar Matopeni tRNA-Sec
    1922. Salmonella enterica subsp. enterica serovar Mbandaka str. ATCC 51958 tRNA-Sec
    1923. Salmonella enterica subsp. enterica serovar Mbandaka tRNA-Sec
    1924. Salmonella enterica subsp. enterica serovar Meleagridis str. 0047 tRNA-Sec
    1925. Salmonella enterica subsp. enterica serovar Meleagridis tRNA-Sec
    1926. Salmonella enterica subsp. enterica serovar Memphis tRNA-Sec
    1927. Salmonella enterica subsp. enterica serovar Mendoza tRNA-Sec
    1928. Salmonella enterica subsp. enterica serovar Menston tRNA-Sec
    1929. Salmonella enterica subsp. enterica serovar Mesbit tRNA-Sec
    1930. Salmonella enterica subsp. enterica serovar Mgulani tRNA-Sec
    1931. Salmonella enterica subsp. enterica serovar Miami str. 1923 tRNA-Sec
    1932. Salmonella enterica subsp. enterica serovar Miami str. CFSAN000579 tRNA-Sec
    1933. Salmonella enterica subsp. enterica serovar Miami tRNA-Sec
    1934. Salmonella enterica subsp. enterica serovar Michigan tRNA-Sec
    1935. Salmonella enterica subsp. enterica serovar Middlesbrough tRNA-Sec
    1936. Salmonella enterica subsp. enterica serovar Midway tRNA-Sec
    1937. Salmonella enterica subsp. enterica serovar Mikawasima tRNA-Sec
    1938. Salmonella enterica subsp. enterica serovar Millesi tRNA-Sec
    1939. Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 tRNA-Sec
    1940. Salmonella enterica subsp. enterica serovar Minneapolis tRNA-Sec
    1941. Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 tRNA-Sec
    1942. Salmonella enterica subsp. enterica serovar Minnesota tRNA-Sec
    1943. Salmonella enterica subsp. enterica serovar Mishmarhaemek tRNA-Sec
    1944. Salmonella enterica subsp. enterica serovar Mississippi tRNA-Sec
    1945. Salmonella enterica subsp. enterica serovar Moero tRNA-Sec
    1946. Salmonella enterica subsp. enterica serovar Mokola tRNA-Sec
    1947. Salmonella enterica subsp. enterica serovar Molade tRNA-Sec
    1948. Salmonella enterica subsp. enterica serovar Monophasic tRNA-Sec
    1949. Salmonella enterica subsp. enterica serovar Monschaui tRNA-Sec
    1950. Salmonella enterica subsp. enterica serovar Montevideo str. 42N tRNA-Sec
    1951. Salmonella enterica subsp. enterica serovar Montevideo str. 507440-20 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1952. Salmonella enterica subsp. enterica serovar Montevideo str. 531954 tRNA-Sec
    1953. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-2 tRNA-Sec
    1954. Salmonella enterica subsp. enterica serovar Montevideo str. 644129 tRNA-Sec
    1955. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 07-0954 tRNA-Sec
    1956. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 08-1942 tRNA-Sec
    1957. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 tRNA-Sec
    1958. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 tRNA-Sec
    1959. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2011K-1674 tRNA-Sec
    1960. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2012K-1544 tRNA-Sec
    1961. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2013K-0218 tRNA-Sec
    1962. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 86-0391 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1963. Salmonella enterica subsp. enterica serovar Montevideo str. CFSAN004346 tRNA-Sec
    1964. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-2868 tRNA-Sec
    1965. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4673 tRNA-Sec
    1966. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4843 tRNA-Sec
    1967. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4916 tRNA-Sec
    1968. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4922 tRNA-Sec
    1969. Salmonella enterica subsp. enterica serovar Montevideo str. FVM_628064 tRNA-Sec
    1970. Salmonella enterica subsp. enterica serovar Montevideo str. N19965 tRNA-Sec
    1971. Salmonella enterica subsp. enterica serovar Montevideo str. SARB31 tRNA-Sec
    1972. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1900 tRNA-Sec
    1973. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1901 tRNA-Sec
    1974. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1903 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    1975. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1904 tRNA-Sec
    1976. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1912 tRNA-Sec
    1977. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 tRNA-Sec
    1978. Salmonella enterica subsp. enterica serovar Montevideo tRNA-Sec
    1979. Salmonella enterica subsp. enterica serovar Morehead tRNA-Sec
    1980. Salmonella enterica subsp. enterica serovar Moroto tRNA-Sec
    1981. Salmonella enterica subsp. enterica serovar Moscow str. S-1843 tRNA-Sec
    1982. Salmonella enterica subsp. enterica serovar Moscow str. SA20061414 tRNA-Sec
    1983. Salmonella enterica subsp. enterica serovar Moscow tRNA-Sec
    1984. Salmonella enterica subsp. enterica serovar Mountpleasant tRNA-Sec
    1985. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000585 tRNA-Sec
    1986. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000591 tRNA-Sec
    1987. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000593 tRNA-Sec
    1988. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000595 tRNA-Sec
    1989. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000596 tRNA-Sec
    1990. Salmonella enterica subsp. enterica serovar Muenchen str. RKS4129 tRNA-Sec
    1991. Salmonella enterica subsp. enterica serovar Muenchen tRNA-Sec
    1992. Salmonella enterica subsp. enterica serovar Muenster str. 0315 tRNA-Sec
    1993. Salmonella enterica subsp. enterica serovar Muenster str. 420 tRNA-Sec
    1994. Salmonella enterica subsp. enterica serovar Muenster str. 660 tRNA-Sec
    1995. Salmonella enterica subsp. enterica serovar Muenster str. CFSAN004344 tRNA-Sec
    1996. Salmonella enterica subsp. enterica serovar Muenster tRNA-Sec
    1997. Salmonella enterica subsp. enterica serovar Nagoya tRNA-Sec
    1998. Salmonella enterica subsp. enterica serovar Namur str. 05-2929 tRNA-Sec
    1999. Salmonella enterica subsp. enterica serovar Napoli tRNA-Sec
    2000. Salmonella enterica subsp. enterica serovar Nchanga tRNA-Sec
    2001. Salmonella enterica subsp. enterica serovar Ndolo tRNA-Sec
    2002. Salmonella enterica subsp. enterica serovar Nessziona tRNA-Sec
    2003. Salmonella enterica subsp. enterica serovar Neukoelln tRNA-Sec
    2004. Salmonella enterica subsp. enterica serovar Neunkirchen tRNA-Sec
    2005. Salmonella enterica subsp. enterica serovar Newbrunswick tRNA-Sec
    2006. Salmonella enterica subsp. enterica serovar Newington tRNA-Sec
    2007. Salmonella enterica subsp. enterica serovar Newlands tRNA-Sec
    2008. Salmonella enterica subsp. enterica serovar Newmexico tRNA-Sec
    2009. Salmonella enterica subsp. enterica serovar Newport str. #11-2 tRNA-Sec
    2010. Salmonella enterica subsp. enterica serovar Newport str. #11-3 tRNA-Sec
    2011. Salmonella enterica subsp. enterica serovar Newport str. #11-4 tRNA-Sec
    2012. Salmonella enterica subsp. enterica serovar Newport str. A-211-RVH tRNA-Sec
    2013. Salmonella enterica subsp. enterica serovar Newport str. A-211-TTX tRNA-Sec
    2014. Salmonella enterica subsp. enterica serovar Newport str. CDC 2009K-1331 tRNA-Sec
    2015. Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2016. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 tRNA-Sec
    2017. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 tRNA-Sec
    2018. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000597 tRNA-Sec
    2019. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000598 tRNA-Sec
    2020. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000826 tRNA-Sec
    2021. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000827 tRNA-Sec
    2022. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000828 tRNA-Sec
    2023. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000829 tRNA-Sec
    2024. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000830 tRNA-Sec
    2025. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000831 tRNA-Sec
    2026. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000832 tRNA-Sec
    2027. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000833 tRNA-Sec
    2028. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000834 tRNA-Sec
    2029. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000835 tRNA-Sec
    2030. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000837 tRNA-Sec
    2031. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000901 tRNA-Sec
    2032. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001889 tRNA-Sec
    2033. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001890 tRNA-Sec
    2034. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001894 tRNA-Sec
    2035. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001895 tRNA-Sec
    2036. Salmonella enterica subsp. enterica serovar Newport str. CVM17619 tRNA-Sec
    2037. Salmonella enterica subsp. enterica serovar Newport str. CVM18000 tRNA-Sec
    2038. Salmonella enterica subsp. enterica serovar Newport str. CVM18005 tRNA-Sec
    2039. Salmonella enterica subsp. enterica serovar Newport str. CVM20775 tRNA-Sec
    2040. Salmonella enterica subsp. enterica serovar Newport str. CVM20776 tRNA-Sec
    2041. Salmonella enterica subsp. enterica serovar Newport str. CVM21537 tRNA-Sec
    2042. Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2043. Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2044. Salmonella enterica subsp. enterica serovar Newport str. CVM 21554 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2045. Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2046. Salmonella enterica subsp. enterica serovar Newport str. CVM22443 tRNA-Sec
    2047. Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2048. Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2049. Salmonella enterica subsp. enterica serovar Newport str. CVM22697 tRNA-Sec
    2050. Salmonella enterica subsp. enterica serovar Newport str. CVM22699 tRNA-Sec
    2051. Salmonella enterica subsp. enterica serovar Newport str. CVM22707 tRNA-Sec
    2052. Salmonella enterica subsp. enterica serovar Newport str. CVM24403 tRNA-Sec
    2053. Salmonella enterica subsp. enterica serovar Newport str. CVM30171 tRNA-Sec
    2054. Salmonella enterica subsp. enterica serovar Newport str. CVM34519 tRNA-Sec
    2055. Salmonella enterica subsp. enterica serovar Newport str. CVM 37978 tRNA-Sec
    2056. Salmonella enterica subsp. enterica serovar Newport str. CVM75_1280 tRNA-Sec
    2057. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1357 tRNA-Sec
    2058. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1594 tRNA-Sec
    2059. Salmonella enterica subsp. enterica serovar Newport str. CVM80_2288 tRNA-Sec
    2060. Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2061. Salmonella enterica subsp. enterica serovar Newport str. CVM N18486 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2062. Salmonella enterica subsp. enterica serovar Newport str. JS09102 tRNA-Sec
    2063. Salmonella enterica subsp. enterica serovar Newport str. L0167 tRNA-Sec
    2064. Salmonella enterica subsp. enterica serovar Newport str. Levine 15 tRNA-Sec
    2065. Salmonella enterica subsp. enterica serovar Newport str. Levine 1 tRNA-Sec
    2066. Salmonella enterica subsp. enterica serovar Newport str. S09097 tRNA-Sec
    2067. Salmonella enterica subsp. enterica serovar Newport str. SHSN007 tRNA-Sec
    2068. Salmonella enterica subsp. enterica serovar Newport str. SHSN009 tRNA-Sec
    2069. Salmonella enterica subsp. enterica serovar Newport str. SHSN010 tRNA-Sec
    2070. Salmonella enterica subsp. enterica serovar Newport str. SHSN013 tRNA-Sec
    2071. Salmonella enterica subsp. enterica serovar Newport str. SL254 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2072. Salmonella enterica subsp. enterica serovar Newport str. SL317 tRNA-Sec
    2073. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 tRNA-Sec
    2074. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 tRNA-Sec
    2075. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 tRNA-Sec
    2076. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 tRNA-Sec
    2077. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1927 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2078. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 tRNA-Sec
    2079. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 tRNA-Sec
    2080. Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2081. Salmonella enterica subsp. enterica serovar Newport str. WA_14882 tRNA-Sec
    2082. Salmonella enterica subsp. enterica serovar Newport tRNA-Sec
    2083. Salmonella enterica subsp. enterica serovar Newyork tRNA-Sec
    2084. Salmonella enterica subsp. enterica serovar Ngili tRNA-Sec
    2085. Salmonella enterica subsp. enterica serovar Nigeria tRNA-Sec
    2086. Salmonella enterica subsp. enterica serovar Nijmegen tRNA-Sec
    2087. Salmonella enterica subsp. enterica serovar Nima tRNA-Sec
    2088. Salmonella enterica subsp. enterica serovar Nitra tRNA-Sec
    2089. Salmonella enterica subsp. enterica serovar Norwich str. CFSAN001077 tRNA-Sec
    2090. Salmonella enterica subsp. enterica serovar Norwich tRNA-Sec
    2091. Salmonella enterica subsp. enterica serovar Nottingham tRNA-Sec
    2092. Salmonella enterica subsp. enterica serovar Noya tRNA-Sec
    2093. Salmonella enterica subsp. enterica serovar Nyanza tRNA-Sec
    2094. Salmonella enterica subsp. enterica serovar Oakland tRNA-Sec
    2095. Salmonella enterica subsp. enterica serovar Obogu tRNA-Sec
    2096. Salmonella enterica subsp. enterica serovar Odozi tRNA-Sec
    2097. Salmonella enterica subsp. enterica serovar Offa tRNA-Sec
    2098. Salmonella enterica subsp. enterica serovar Ohio str. CFSAN001079 tRNA-Sec
    2099. Salmonella enterica subsp. enterica serovar Ohio tRNA-Sec
    2100. Salmonella enterica subsp. enterica serovar Okatie tRNA-Sec
    2101. Salmonella enterica subsp. enterica serovar Omuna tRNA-Sec
    2102. Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 tRNA-Sec
    2103. Salmonella enterica subsp. enterica serovar Onderstepoort tRNA-Sec
    2104. Salmonella enterica subsp. enterica serovar Onireke tRNA-Sec
    2105. Salmonella enterica subsp. enterica serovar Oranienburg str. 0250 tRNA-Sec
    2106. Salmonella enterica subsp. enterica serovar Oranienburg str. 701 tRNA-Sec
    2107. Salmonella enterica subsp. enterica serovar Oranienburg str. S-76 tRNA-Sec
    2108. Salmonella enterica subsp. enterica serovar Oranienburg tRNA-Sec
    2109. Salmonella enterica subsp. enterica serovar Ordonez tRNA-Sec
    2110. Salmonella enterica subsp. enterica serovar Orientalis tRNA-Sec
    2111. Salmonella enterica subsp. enterica serovar Orion tRNA-Sec
    2112. Salmonella enterica subsp. enterica serovar O rough tRNA-Sec
    2113. Salmonella enterica subsp. enterica serovar Oskarshamn tRNA-Sec
    2114. Salmonella enterica subsp. enterica serovar Oslo tRNA-Sec
    2115. Salmonella enterica subsp. enterica serovar Othmarschen tRNA-Sec
    2116. Salmonella enterica subsp. enterica serovar Ouagadougou tRNA-Sec
    2117. Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 tRNA-Sec
    2118. Salmonella enterica subsp. enterica serovar Ouakam tRNA-Sec
    2119. Salmonella enterica subsp. enterica serovar Oudwijk tRNA-Sec
    2120. Salmonella enterica subsp. enterica serovar Overschie tRNA-Sec
    2121. Salmonella enterica subsp. enterica serovar Pakistan tRNA-Sec
    2122. Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 tRNA-Sec
    2123. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000600 tRNA-Sec
    2124. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000601 tRNA-Sec
    2125. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000602 tRNA-Sec
    2126. Salmonella enterica subsp. enterica serovar Panama str. SA20030878 tRNA-Sec
    2127. Salmonella enterica subsp. enterica serovar Panama tRNA-Sec
    2128. Salmonella enterica subsp. enterica serovar Papuana tRNA-Sec
    2129. Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2130. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 tRNA-Sec
    2131. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2132. Salmonella enterica subsp. enterica serovar Paratyphi A str. SA19950809 tRNA-Sec
    2133. Salmonella enterica subsp. enterica serovar Paratyphi A tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2134. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 10719 tRNA-Sec
    2135. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 19940 tRNA-Sec
    2136. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 51962 tRNA-Sec
    2137. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 8759 tRNA-Sec
    2138. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC BAA-1585 tRNA-Sec
    2139. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000527 tRNA-Sec
    2140. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000532 tRNA-Sec
    2141. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000536 tRNA-Sec
    2142. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000540 tRNA-Sec
    2143. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000541 tRNA-Sec
    2144. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000542 tRNA-Sec
    2145. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000545 tRNA-Sec
    2146. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000547 tRNA-Sec
    2147. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000548 tRNA-Sec
    2148. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000549 tRNA-Sec
    2149. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA42 tRNA-Sec
    2150. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA56 tRNA-Sec
    2151. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA61 tRNA-Sec
    2152. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA62 tRNA-Sec
    2153. Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2154. Salmonella enterica subsp. enterica serovar Paratyphi B tRNA-Sec
    2155. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000603 tRNA-Sec
    2156. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000604 tRNA-Sec
    2157. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000605 tRNA-Sec
    2158. Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2159. Salmonella enterica subsp. enterica serovar Paratyphi C tRNA-Sec
    2160. Salmonella enterica subsp. enterica serovar Parkroyal tRNA-Sec
    2161. Salmonella enterica subsp. enterica serovar Pasing tRNA-Sec
    2162. Salmonella enterica subsp. enterica serovar Penarth tRNA-Sec
    2163. Salmonella enterica subsp. enterica serovar Pensacola tRNA-Sec
    2164. Salmonella enterica subsp. enterica serovar Plymouth tRNA-Sec
    2165. Salmonella enterica subsp. enterica serovar Poano tRNA-Sec
    2166. Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 tRNA-Sec
    2167. Salmonella enterica subsp. enterica serovar Pomona tRNA-Sec
    2168. Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 tRNA-Sec
    2169. Salmonella enterica subsp. enterica serovar Poona tRNA-Sec
    2170. Salmonella enterica subsp. enterica serovar Potsdam tRNA-Sec
    2171. Salmonella enterica subsp. enterica serovar Praha tRNA-Sec
    2172. Salmonella enterica subsp. enterica serovar Pretoria tRNA-Sec
    2173. Salmonella enterica subsp. enterica serovar Pullorum str. 13036 tRNA-Sec
    2174. Salmonella enterica subsp. enterica serovar Pullorum str. 19945 tRNA-Sec
    2175. Salmonella enterica subsp. enterica serovar Pullorum str. ATCC 9120 tRNA-Sec
    2176. Salmonella enterica subsp. enterica serovar Pullorum str. CFSAN000606 tRNA-Sec
    2177. Salmonella enterica subsp. enterica serovar Pullorum str. S06004 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2178. Salmonella enterica subsp. enterica serovar Pullorum tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2179. Salmonella enterica subsp. enterica serovar Putten tRNA-Sec
    2180. Salmonella enterica subsp. enterica serovar Quebec str. S-1267 tRNA-Sec
    2181. Salmonella enterica subsp. enterica serovar -:r:1,5 tRNA-Sec
    2182. Salmonella enterica subsp. enterica serovar Ramatgan tRNA-Sec
    2183. Salmonella enterica subsp. enterica serovar Rauform tRNA-Sec
    2184. Salmonella enterica subsp. enterica serovar Reading tRNA-Sec
    2185. Salmonella enterica subsp. enterica serovar Redba tRNA-Sec
    2186. Salmonella enterica subsp. enterica serovar Redlands tRNA-Sec
    2187. Salmonella enterica subsp. enterica serovar Remiremont tRNA-Sec
    2188. Salmonella enterica subsp. enterica serovar Remo tRNA-Sec
    2189. Salmonella enterica subsp. enterica serovar Richmond tRNA-Sec
    2190. Salmonella enterica subsp. enterica serovar Rideau tRNA-Sec
    2191. Salmonella enterica subsp. enterica serovar Ridge tRNA-Sec
    2192. Salmonella enterica subsp. enterica serovar Rissen str. 150 tRNA-Sec
    2193. Salmonella enterica subsp. enterica serovar Rissen tRNA-Sec
    2194. Salmonella enterica subsp. enterica serovar Roodepoort tRNA-Sec
    2195. Salmonella enterica subsp. enterica serovar Rostock tRNA-Sec
    2196. Salmonella enterica subsp. enterica serovar Rottnest tRNA-Sec
    2197. Salmonella enterica subsp. enterica serovar Rough:b:1,2 tRNA-Sec
    2198. Salmonella enterica subsp. enterica serovar Rough O:d:1,7 tRNA-Sec
    2199. Salmonella enterica subsp. enterica serovar Rough O:-:- tRNA-Sec
    2200. Salmonella enterica subsp. enterica serovar Rough:- tRNA-Sec
    2201. Salmonella enterica subsp. enterica serovar Rovaniemi tRNA-Sec
    2202. Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 tRNA-Sec
    2203. Salmonella enterica subsp. enterica serovar Rubislaw str. SA20030553 tRNA-Sec
    2204. Salmonella enterica subsp. enterica serovar Rubislaw tRNA-Sec
    2205. Salmonella enterica subsp. enterica serovar Ruiru tRNA-Sec
    2206. Salmonella enterica subsp. enterica serovar Saarbruecken tRNA-Sec
    2207. Salmonella enterica subsp. enterica serovar Saintpaul str. 9712 tRNA-Sec
    2208. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000612 tRNA-Sec
    2209. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000618 tRNA-Sec
    2210. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000619 tRNA-Sec
    2211. Salmonella enterica subsp. enterica serovar Saintpaul str. JO2008 tRNA-Sec
    2212. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA23 tRNA-Sec
    2213. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA26 tRNA-Sec
    2214. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA29 tRNA-Sec
    2215. Salmonella enterica subsp. enterica serovar Saintpaul tRNA-Sec
    2216. Salmonella enterica subsp. enterica serovar Salford tRNA-Sec
    2217. Salmonella enterica subsp. enterica serovar Sandiego tRNA-Sec
    2218. Salmonella enterica subsp. enterica serovar Sangera tRNA-Sec
    2219. Salmonella enterica subsp. enterica serovar Sanjuan tRNA-seC(tca)
    2220. Salmonella enterica subsp. enterica serovar Saphra tRNA-Sec
    2221. Salmonella enterica subsp. enterica serovar Sarajane tRNA-Sec
    2222. Salmonella enterica subsp. enterica serovar Schleissheim tRNA-Sec
    2223. Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2224. Salmonella enterica subsp. enterica serovar Schwarzengrund str. SL480 tRNA-Sec
    2225. Salmonella enterica subsp. enterica serovar Schwarzengrund tRNA-Sec
    2226. Salmonella enterica subsp. enterica serovar Seattle tRNA-Sec
    2227. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-Sec
    2228. Salmonella enterica subsp. enterica serovar Sekondi tRNA-Sec
    2229. Salmonella enterica subsp. enterica serovar Sendai str. CFSAN000621 tRNA-Sec
    2230. Salmonella enterica subsp. enterica serovar Sendai tRNA-Sec
    2231. Salmonella enterica subsp. enterica serovar Senegal tRNA-Sec
    2232. Salmonella enterica subsp. enterica serovar Senftenberg str. 316235162 tRNA-Sec
    2233. Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 tRNA-Sec
    2234. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-1 tRNA-Sec
    2235. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-2 tRNA-Sec
    2236. Salmonella enterica subsp. enterica serovar Senftenberg str. 604314 tRNA-Sec
    2237. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 tRNA-Sec
    2238. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 8400 tRNA-Sec
    2239. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 tRNA-Sec
    2240. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004030 tRNA-Sec
    2241. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004031 tRNA-Sec
    2242. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004032 tRNA-Sec
    2243. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004033 tRNA-Sec
    2244. Salmonella enterica subsp. enterica serovar Senftenberg str. NC_MB012510-0038 tRNA-Sec
    2245. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-SeC
    2246. Salmonella enterica subsp. enterica serovar Senneville tRNA-Sec
    2247. Salmonella enterica subsp. enterica serovar Shamba tRNA-Sec
    2248. Salmonella enterica subsp. enterica serovar Shubra tRNA-Sec
    2249. Salmonella enterica subsp. enterica serovar Singapore tRNA-Sec
    2250. Salmonella enterica subsp. enterica serovar Sinstorf tRNA-Sec
    2251. Salmonella enterica subsp. enterica serovar Sloterdijk str. ATCC 15791 tRNA-Sec
    2252. Salmonella enterica subsp. enterica serovar Solt tRNA-Sec
    2253. Salmonella enterica subsp. enterica serovar Somone tRNA-Sec
    2254. Salmonella enterica subsp. enterica serovar Southampton tRNA-Sec
    2255. Salmonella enterica subsp. enterica serovar Southbank tRNA-Sec
    2256. Salmonella enterica subsp. enterica serovar Stanley str. ATCC 7308 tRNA-Sec
    2257. Salmonella enterica subsp. enterica serovar Stanley str. CFSAN000623 tRNA-Sec
    2258. Salmonella enterica subsp. enterica serovar Stanley tRNA-Sec
    2259. Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 tRNA-Sec
    2260. Salmonella enterica subsp. enterica serovar Stanleyville tRNA-Sec
    2261. Salmonella enterica subsp. enterica serovar Stockholm tRNA-Sec
    2262. Salmonella enterica subsp. enterica serovar Stourbridge tRNA-Sec
    2263. Salmonella enterica subsp. enterica serovar Strathcona tRNA-Sec
    2264. Salmonella enterica subsp. enterica serovar Stuttgart tRNA-Sec
    2265. Salmonella enterica subsp. enterica serovar Suberu tRNA-Sec
    2266. Salmonella enterica subsp. enterica serovar Suelldorf tRNA-Sec
    2267. Salmonella enterica subsp. enterica serovar Sundsvall tRNA-Sec
    2268. Salmonella enterica subsp. enterica serovar Szentes tRNA-Sec
    2269. Salmonella enterica subsp. enterica serovar Tafo tRNA-Sec
    2270. Salmonella enterica subsp. enterica serovar Takoradi tRNA-Sec
    2271. Salmonella enterica subsp. enterica serovar Taksony tRNA-Sec
    2272. Salmonella enterica subsp. enterica serovar Tallahassee str. 0012 tRNA-Sec
    2273. Salmonella enterica subsp. enterica serovar Tallahassee tRNA-Sec
    2274. Salmonella enterica subsp. enterica serovar Tamale tRNA-Sec
    2275. Salmonella enterica subsp. enterica serovar Tamberma tRNA-Sec
    2276. Salmonella enterica subsp. enterica serovar Tananarive tRNA-Sec
    2277. Salmonella enterica subsp. enterica serovar Tanger tRNA-Sec
    2278. Salmonella enterica subsp. enterica serovar Tchad tRNA-Sec
    2279. Salmonella enterica subsp. enterica serovar Teddington tRNA-Sec
    2280. Salmonella enterica subsp. enterica serovar Tees tRNA-Sec
    2281. Salmonella enterica subsp. enterica serovar Teko tRNA-Sec
    2282. Salmonella enterica subsp. enterica serovar Telaviv tRNA-Sec
    2283. Salmonella enterica subsp. enterica serovar Telelkebir tRNA-Sec
    2284. Salmonella enterica subsp. enterica serovar Telhashomer tRNA-Sec
    2285. Salmonella enterica subsp. enterica serovar Teltow tRNA-Sec
    2286. Salmonella enterica subsp. enterica serovar Tennessee str. 2691 tRNA-Sec
    2287. Salmonella enterica subsp. enterica serovar Tennessee str. 3133 tRNA-Sec
    2288. Salmonella enterica subsp. enterica serovar Tennessee str. 4535 tRNA-Sec
    2289. Salmonella enterica subsp. enterica serovar Tennessee str. PBO2007 tRNA-Sec
    2290. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-19 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2291. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-21 tRNA-Sec
    2292. Salmonella enterica subsp. enterica serovar Tennessee tRNA-Sec
    2293. Salmonella enterica subsp. enterica serovar Teshie tRNA-Sec
    2294. Salmonella enterica subsp. enterica serovar Texas tRNA-Sec
    2295. Salmonella enterica subsp. enterica serovar Thompson tRNA-Sec
    2296. Salmonella enterica subsp. enterica serovar Tilene tRNA-Sec
    2297. Salmonella enterica subsp. enterica serovar Togba tRNA-Sec
    2298. Salmonella enterica subsp. enterica serovar Toucra tRNA-Sec
    2299. Salmonella enterica subsp. enterica serovar Toulon tRNA-Sec
    2300. Salmonella enterica subsp. enterica serovar Treforest tRNA-Sec
    2301. Salmonella enterica subsp. enterica serovar Tudu tRNA-Sec
    2302. Salmonella enterica subsp. enterica serovar Typhimurium str. 104772 tRNA-Sec
    2303. Salmonella enterica subsp. enterica serovar Typhimurium str. 108402 tRNA-Sec
    2304. Salmonella enterica subsp. enterica serovar Typhimurium str. 116045 tRNA-Sec
    2305. Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2306. Salmonella enterica subsp. enterica serovar Typhimurium str. 34502 tRNA-Sec
    2307. Salmonella enterica subsp. enterica serovar Typhimurium str. 35423 tRNA-Sec
    2308. Salmonella enterica subsp. enterica serovar Typhimurium str. 36618 tRNA-Sec
    2309. Salmonella enterica subsp. enterica serovar Typhimurium str. 798 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2310. Salmonella enterica subsp. enterica serovar Typhimurium str. 86-0368 tRNA-Sec
    2311. Salmonella enterica subsp. enterica serovar Typhimurium str. 95799 tRNA-Sec
    2312. Salmonella enterica subsp. enterica serovar Typhimurium str. 98346 tRNA-Sec
    2313. Salmonella enterica subsp. enterica serovar Typhimurium str. AZ 057 tRNA-Sec
    2314. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1153 tRNA-Sec
    2315. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1158 tRNA-Sec
    2316. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1277 tRNA-Sec
    2317. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1283 tRNA-Sec
    2318. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1288 tRNA-Sec
    2319. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 tRNA-Sec
    2320. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-2059 tRNA-Sec
    2321. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 tRNA-Sec
    2322. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2323. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 tRNA-Sec
    2324. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 tRNA-Sec
    2325. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000648 tRNA-Sec
    2326. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000653 tRNA-Sec
    2327. Salmonella enterica subsp. enterica serovar Typhimurium str. D23580 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2328. Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2329. Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2330. Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2331. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4_delta.ramA::kan tRNA-Sec
    2332. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4 tRNA-Sec
    2333. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2334. Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 tRNA-Sec
    2335. Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2336. Salmonella enterica subsp. enterica serovar Typhimurium str. ST1489 tRNA-Sec
    2337. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4581 tRNA-Sec
    2338. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4/74 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2339. Salmonella enterica subsp. enterica serovar Typhimurium str. STm10 tRNA-Sec
    2340. Salmonella enterica subsp. enterica serovar Typhimurium str. STm11 tRNA-Sec
    2341. Salmonella enterica subsp. enterica serovar Typhimurium str. STm12 tRNA-Sec
    2342. Salmonella enterica subsp. enterica serovar Typhimurium str. STm1 tRNA-Sec
    2343. Salmonella enterica subsp. enterica serovar Typhimurium str. STm2 tRNA-Sec
    2344. Salmonella enterica subsp. enterica serovar Typhimurium str. STm3 tRNA-Sec
    2345. Salmonella enterica subsp. enterica serovar Typhimurium str. STm4 tRNA-Sec
    2346. Salmonella enterica subsp. enterica serovar Typhimurium str. STm5 tRNA-Sec
    2347. Salmonella enterica subsp. enterica serovar Typhimurium str. STm6 tRNA-Sec
    2348. Salmonella enterica subsp. enterica serovar Typhimurium str. STm7 tRNA-Sec
    2349. Salmonella enterica subsp. enterica serovar Typhimurium str. STm8 tRNA-Sec
    2350. Salmonella enterica subsp. enterica serovar Typhimurium str. STm9 tRNA-Sec
    2351. Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2352. Salmonella enterica subsp. enterica serovar Typhimurium str. U288 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2353. Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2354. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 tRNA-Sec
    2355. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 tRNA-Sec
    2356. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 tRNA-Sec
    2357. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 tRNA-Sec
    2358. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 tRNA-Sec
    2359. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2360. Salmonella enterica subsp. enterica serovar Typhimurium tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2361. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN001921 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2362. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN004345 tRNA-Sec
    2363. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- tRNA-Sec
    2364. Salmonella enterica subsp. enterica serovar Typhimurium var. Copenhagen str. 0084 tRNA-Sec
    2365. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,[5],12:i:- tRNA-Sec
    2366. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,5,12:i:- tRNA-Sec
    2367. Salmonella enterica subsp. enterica serovar Typhi (Salmonella typhi) tRNA-Sec
    2368. Salmonella enterica subsp. enterica serovar Typhi str. 404ty tRNA-Sec
    2369. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000626 tRNA-Sec
    2370. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000628 tRNA-Sec
    2371. Salmonella enterica subsp. enterica serovar Typhi str. CT18 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2372. Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2373. Salmonella enterica subsp. enterica serovar Typhi str. STH2370 tRNA-Sec
    2374. Salmonella enterica subsp. enterica serovar Typhi str. Ty21a tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2375. Salmonella enterica subsp. enterica serovar Typhi str. Ty2 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2376. Salmonella enterica subsp. enterica serovar Typhisuis str. CFSAN000654 tRNA-Sec
    2377. Salmonella enterica subsp. enterica serovar Typhisuis tRNA-Sec
    2378. Salmonella enterica subsp. enterica serovar Tyresoe tRNA-Sec
    2379. Salmonella enterica subsp. enterica serovar Uganda tRNA-Sec
    2380. Salmonella enterica subsp. enterica serovar Ughelli tRNA-Sec
    2381. Salmonella enterica subsp. enterica serovar Ullevi tRNA-Sec
    2382. Salmonella enterica subsp. enterica serovar Umbilo tRNA-Sec
    2383. Salmonella enterica subsp. enterica serovar Uppsala tRNA-Sec
    2384. Salmonella enterica subsp. enterica serovar Urbana tRNA-Sec
    2385. Salmonella enterica subsp. enterica serovar Utah tRNA-Sec
    2386. Salmonella enterica subsp. enterica serovar Uzaramo tRNA-Sec
    2387. Salmonella enterica subsp. enterica serovar Vaertan tRNA-Sec
    2388. Salmonella enterica subsp. enterica serovar Vancouver tRNA-Sec
    2389. Salmonella enterica subsp. enterica serovar Vejle tRNA-Sec
    2390. Salmonella enterica subsp. enterica serovar Veneziana tRNA-Sec
    2391. Salmonella enterica subsp. enterica serovar Victoria tRNA-Sec
    2392. Salmonella enterica subsp. enterica serovar Vinohrady tRNA-Sec
    2393. Salmonella enterica subsp. enterica serovar Virchow str. ATCC 51955 tRNA-Sec
    2394. Salmonella enterica subsp. enterica serovar Virchow str. SL491 tRNA-Sec
    2395. Salmonella enterica subsp. enterica serovar Virchow tRNA-Sec
    2396. Salmonella enterica subsp. enterica serovar Virginia str. SA19971529 tRNA-Sec
    2397. Salmonella enterica subsp. enterica serovar Virginia tRNA-Sec
    2398. Salmonella enterica subsp. enterica serovar Vitkin tRNA-Sec
    2399. Salmonella enterica subsp. enterica serovar Volkmarsdorf tRNA-Sec
    2400. Salmonella enterica subsp. enterica serovar Vom tRNA-Sec
    2401. Salmonella enterica subsp. enterica serovar Vuadens tRNA-Sec
    2402. Salmonella enterica subsp. enterica serovar Wagenia tRNA-Sec
    2403. Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 tRNA-Sec
    2404. Salmonella enterica subsp. enterica serovar Wandsworth tRNA-Sec
    2405. Salmonella enterica subsp. enterica serovar Wangata tRNA-Sec
    2406. Salmonella enterica subsp. enterica serovar Warnow tRNA-Sec
    2407. Salmonella enterica subsp. enterica serovar Washington tRNA-Sec
    2408. Salmonella enterica subsp. enterica serovar Wa tRNA-Sec
    2409. Salmonella enterica subsp. enterica serovar Waycross tRNA-Sec
    2410. Salmonella enterica subsp. enterica serovar Wedding tRNA-Sec
    2411. Salmonella enterica subsp. enterica serovar Welikade tRNA-Sec
    2412. Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 tRNA-Sec
    2413. Salmonella enterica subsp. enterica serovar Weltevreden str. HI_N05-537 tRNA-Sec
    2414. Salmonella enterica subsp. enterica serovar Weltevreden tRNA-Sec
    2415. Salmonella enterica subsp. enterica serovar Wentworth tRNA-Sec
    2416. Salmonella enterica subsp. enterica serovar Weslaco str. 247K tRNA-Sec
    2417. Salmonella enterica subsp. enterica serovar Weslaco tRNA-Sec
    2418. Salmonella enterica subsp. enterica serovar Westhampton tRNA-Sec
    2419. Salmonella enterica subsp. enterica serovar Westminster tRNA-Sec
    2420. Salmonella enterica subsp. enterica serovar Weston tRNA-Sec
    2421. Salmonella enterica subsp. enterica serovar Weybridge tRNA-Sec
    2422. Salmonella enterica subsp. enterica serovar Widemarsh tRNA-Sec
    2423. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000656 tRNA-Sec
    2424. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000657 tRNA-Sec
    2425. Salmonella enterica subsp. enterica serovar Wien tRNA-Sec
    2426. Salmonella enterica subsp. enterica serovar Wilhelmsburg tRNA-Sec
    2427. Salmonella enterica subsp. enterica serovar Winterthur tRNA-Sec
    2428. Salmonella enterica subsp. enterica serovar Woodhull tRNA-Sec
    2429. Salmonella enterica subsp. enterica serovar Woodinville tRNA-Sec
    2430. Salmonella enterica subsp. enterica serovar Worthington str. ATCC 9607 tRNA-Sec
    2431. Salmonella enterica subsp. enterica serovar Worthington str. BCH-3194 tRNA-Sec
    2432. Salmonella enterica subsp. enterica serovar Worthington str. BCH-5715 tRNA-Sec
    2433. Salmonella enterica subsp. enterica serovar Worthington str. BCH-7253 tRNA-Sec
    2434. Salmonella enterica subsp. enterica serovar Worthington tRNA-Sec
    2435. Salmonella enterica subsp. enterica serovar Wyldegreen tRNA-Sec
    2436. Salmonella enterica subsp. enterica serovar Yolo tRNA-Sec
    2437. Salmonella enterica subsp. enterica serovar Yoruba tRNA-Sec
    2438. Salmonella enterica subsp. enterica serovar Yovokome str. S-1850 tRNA-Sec
    2439. Salmonella enterica subsp. enterica serovar Yovokome tRNA-Sec
    2440. Salmonella enterica subsp. enterica serovar Zaiman tRNA-Sec
    2441. Salmonella enterica subsp. enterica serovar Zanzibar tRNA-Sec
    2442. Salmonella enterica subsp. enterica tRNA-Sec
    2443. Salmonella enterica subsp. houtenae serovar 1,40:z4,z32:- tRNA-Sec
    2444. Salmonella enterica subsp. houtenae serovar 16:z4,z32:- tRNA-Sec
    2445. Salmonella enterica subsp. houtenae serovar 18:z36,z38:- tRNA-Sec
    2446. Salmonella enterica subsp. houtenae serovar 21:z4,z23:- tRNA-Sec
    2447. Salmonella enterica subsp. houtenae serovar 40:z4,z24:- tRNA-Sec
    2448. Salmonella enterica subsp. houtenae serovar 40:z4,z32:- tRNA-Sec
    2449. Salmonella enterica subsp. houtenae serovar 41:z4,z23:- tRNA-Sec
    2450. Salmonella enterica subsp. houtenae serovar 43:z4 tRNA-Sec
    2451. Salmonella enterica subsp. houtenae serovar 43:z4,z23:- tRNA-Sec
    2452. Salmonella enterica subsp. houtenae serovar 43:z4,z32:- tRNA-Sec
    2453. Salmonella enterica subsp. houtenae serovar 44:z36,[z38]:- tRNA-Sec
    2454. Salmonella enterica subsp. houtenae serovar 44:z36[z38]:- tRNA-Sec
    2455. Salmonella enterica subsp. houtenae serovar 44:z4,z23:- tRNA-Sec
    2456. Salmonella enterica subsp. houtenae serovar 44:z4,z24:- tRNA-Sec
    2457. Salmonella enterica subsp. houtenae serovar 45:g,z51:- tRNA-Sec
    2458. Salmonella enterica subsp. houtenae serovar 48:g,z51:- tRNA-Sec
    2459. Salmonella enterica subsp. houtenae serovar 48:z4,z32:- tRNA-Sec
    2460. Salmonella enterica subsp. houtenae serovar 50:g,z51:- str. 01-0133 tRNA-Sec
    2461. Salmonella enterica subsp. houtenae serovar 50:g,z51:- tRNA-Sec
    2462. Salmonella enterica subsp. houtenae serovar 50:z4,z23:- tRNA-Sec
    2463. Salmonella enterica subsp. houtenae serovar 53:z4,z23:- tRNA-Sec
    2464. Salmonella enterica subsp. houtenae serovar Houten tRNA-Sec
    2465. Salmonella enterica subsp. houtenae serovar O:11:g,z25:- tRNA-Sec
    2466. Salmonella enterica subsp. houtenae str. CFSAN000552 tRNA-Sec
    2467. Salmonella enterica subsp. houtenae str. CFSAN000557 tRNA-Sec
    2468. Salmonella enterica subsp. houtenae tRNA-Sec
    2469. Salmonella enterica subsp. indica serovar 41:b:1,7 tRNA-Sec
    2470. Salmonella enterica subsp. indica serovar 45:a:e,n,x tRNA-Sec
    2471. Salmonella enterica subsp. indica serovar 6,14,25:z10:1,(2),7 str. 1121 tRNA-Sec
    2472. Salmonella enterica subsp. indica serovar Marseille tRNA-Sec
    2473. Salmonella enterica subsp. indica tRNA-Sec
    2474. Salmonella enterica subsp. salamae serovar 18:z10:z6 tRNA-Sec
    2475. Salmonella enterica subsp. salamae serovar 30:1,z28:z6 tRNA-Sec
    2476. Salmonella enterica subsp. salamae serovar 42:b:1,5 tRNA-Sec
    2477. Salmonella enterica subsp. salamae serovar 42:f,g,t:-- tRNA-Sec
    2478. Salmonella enterica subsp. salamae serovar 42:z:1,5 tRNA-Sec
    2479. Salmonella enterica subsp. salamae serovar 47:a:1,5 tRNA-Sec
    2480. Salmonella enterica subsp. salamae serovar 47:b:1,5 tRNA-Sec
    2481. Salmonella enterica subsp. salamae serovar 48:d:z6 tRNA-Sec
    2482. Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K tRNA-Sec
    2483. Salmonella enterica subsp. salamae serovar 56:b:[1,5] tRNA-Sec
    2484. Salmonella enterica subsp. salamae serovar 56:z10:e,n,x str. 1369-73 tRNA-Sec
    2485. Salmonella enterica subsp. salamae serovar 57:z29:z42 tRNA-Sec
    2486. Salmonella enterica subsp. salamae serovar 58:a:- tRNA-Sec
    2487. Salmonella enterica subsp. salamae serovar 58:d:z6 tRNA-Sec
    2488. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 str. 00-0163 tRNA-Sec
    2489. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 tRNA-Sec
    2490. Salmonella enterica subsp. salamae serovar 60:g,m,t:z6 tRNA-Sec
    2491. Salmonella enterica subsp. salamae serovar 6,7:m,t:- tRNA-Sec
    2492. Salmonella enterica subsp. salamae serovar Greenside tRNA-seC(tca)
    2493. Salmonella enterica subsp. salamae serovar Sofia tRNA-Sec
    2494. Salmonella enterica subsp. salamae serovar Springs tRNA-Sec
    2495. Salmonella enterica subsp. salamae str. CFSAN000559 tRNA-Sec
    2496. Salmonella enterica subsp. salamae tRNA-Sec
    2497. Salmonella enterica subsp. VII serovar 1,40:g,z51:-- tRNA-Sec
    2498. Salmonella enterica subsp. VII serovar 40:z4,z24:[z39] tRNA-Sec
    2499. Salmonella enterica subsp. VII str. CFSAN000554 tRNA-Sec
    2500. Salmonella enterica tRNA-SeC
    2501. Salmonella sp. 32010201201800099SM tRNA-Sec
    2502. Salmonella sp. 32010601-2015-00010-FB-01-SM-01 tRNA-Sec
    2503. Salmonella sp. 32010601-2015-00137-FB-01-SM-01 tRNA-Sec
    2504. Salmonella sp. 32010601201600067SM tRNA-Sec
    2505. Salmonella sp. 32010601201800030SM tRNA-Sec
    2506. Salmonella sp. 32011103201800031SM tRNA-Sec
    2507. Salmonella sp. 32011103201800106SM tRNA-Sec
    2508. Salmonella sp. 32011401201800036SM tRNA-Sec
    2509. Salmonella sp. 32011401-201800074SM tRNA-Sec
    2510. Salmonella sp. 32011501201800079SM tRNA-Sec
    2511. Salmonella sp. 32011602201600097SM tRNA-Sec
    2512. Salmonella sp. 32011602201600105SM tRNA-Sec
    2513. Salmonella sp. 32011602201800010SM tRNA-Sec
    2514. Salmonella sp. 32011602201800014SM tRNA-Sec
    2515. Salmonella sp. 32011801201800027SM tRNA-Sec
    2516. Salmonella sp. 32020114201800008SM tRNA-Sec
    2517. Salmonella sp. 32020201-2017-00050-FB-01-SM-01 tRNA-Sec
    2518. Salmonella sp. 32020210201800012SM tRNA-Sec
    2519. Salmonella sp. 32020301-2015-00098-FB-01-SM-01 tRNA-Sec
    2520. Salmonella sp. 32020501-2019-00039 tRNA-Sec
    2521. Salmonella sp. 32020501-2019-00040 tRNA-Sec
    2522. Salmonella sp. 32020501-2019-00041 tRNA-Sec
    2523. Salmonella sp. 32020501-2019-00044 tRNA-Sec
    2524. Salmonella sp. 32020501-2019-00052 tRNA-Sec
    2525. Salmonella sp. 32020509201800054SM tRNA-Sec
    2526. Salmonella sp. 32020509201800068SM tRNA-Sec
    2527. Salmonella sp. 32020512-2019-00017 tRNA-Sec
    2528. Salmonella sp. 32020614-2019-00048 tRNA-Sec
    2529. Salmonella sp. 32021105201800037SM tRNA-Sec
    2530. Salmonella sp. 32031101201600128SM tRNA-Sec
    2531. Salmonella sp. 3203110320150106SM tRNA-Sec
    2532. Salmonella sp. 32031103201600220SM tRNA-Sec
    2533. Salmonella sp. 32031103201600241SM tRNA-Sec
    2534. Salmonella sp. 32031103201600284SM tRNA-Sec
    2535. Salmonella sp. 32031103201600383SM tRNA-Sec
    2536. Salmonella sp. 3203110320160044 tRNA-Sec
    2537. Salmonella sp. 3203110320160052 tRNA-Sec
    2538. Salmonella sp. 3203110320160127 tRNA-Sec
    2539. Salmonella sp. 3203110320160165 tRNA-Sec
    2540. Salmonella sp. 3203110320160211 tRNA-Sec
    2541. Salmonella sp. 32031103-2018-00083-FB-01-SM-01 tRNA-Sec
    2542. Salmonella sp. 32031103-2018-0023-FB-01-SM-01 tRNA-Sec
    2543. Salmonella sp. 32040203201700113FB01SM01 tRNA-Sec
    2544. Salmonella sp. 32040203-2019-00004 tRNA-Sec
    2545. Salmonella sp. 32040203-2019-00032 tRNA-Sec
    2546. Salmonella sp. 32040203-2019-00058 tRNA-Sec
    2547. Salmonella sp. 32040203-2019-00061 tRNA-Sec
    2548. Salmonella sp. 32040203-2019-00097 tRNA-Sec
    2549. Salmonella sp. 32040203-2019-00118 tRNA-Sec
    2550. Salmonella sp. 32040203-2019-00127 tRNA-Sec
    2551. Salmonella sp. 32040203-2019-00133 tRNA-Sec
    2552. Salmonella sp. 32040203-2019-00159 tRNA-Sec
    2553. Salmonella sp. 32040209201700048FB01SM01 tRNA-Sec
    2554. Salmonella sp. 32048101-2015-00023-GS-01-SM-01 tRNA-Sec
    2555. Salmonella sp. 32048101-2015-00025-GS-01-SM-01 tRNA-Sec
    2556. Salmonella sp. 32058101201500184GS-01-SM-01 tRNA-Sec
    2557. Salmonella sp. 32070006-2019-00075 tRNA-Sec
    2558. Salmonella sp. 32070301201500052SM tRNA-Sec
    2559. Salmonella sp. 32070601201500089SM tRNA-Sec
    2560. Salmonella sp. 32080201-2017-00039-FB-01-SM-01 tRNA-Sec
    2561. Salmonella sp. 32081101-2017-00024-FB-01-SM-01 tRNA-Sec
    2562. Salmonella sp. 32082101201600294FB01SM01 tRNA-Sec
    2563. Salmonella sp. 32082101-2017-00322-FB-01-SM-01 tRNA-Sec
    2564. Salmonella sp. 32082101-2019-00528 tRNA-Sec
    2565. Salmonella sp. 32090202-2015-00079-FB-01-SM-01 tRNA-Sec
    2566. Salmonella sp. 32100201201700021SM tRNA-Sec
    2567. Salmonella sp. 32100201201700044SM tRNA-Sec
    2568. Salmonella sp. 32100201201700098SM tRNA-Sec
    2569. Salmonella sp. 32100201201700099SM tRNA-Sec
    2570. Salmonella sp. 32100201201700133SM tRNA-Sec
    2571. Salmonella sp. 32100202201700047SM tRNA-Sec
    2572. Salmonella sp. 32100202201700100SM tRNA-Sec
    2573. Salmonella sp. 32101201-2018-00131-FB-01-SM-01 tRNA-Sec
    2574. Salmonella sp. 32118201201500025SM tRNA-Sec
    2575. Salmonella sp. 32120201201500036SM tRNA-Sec
    2576. Salmonella sp. 32120201201600049SM tRNA-Sec
    2577. Salmonella sp. 32120201201600070SM tRNA-Sec
    2578. Salmonella sp. 32120201201700095FB-01-SM-01 tRNA-Sec
    2579. Salmonella sp. 32120201201700135FB-01-SM-01 tRNA-Sec
    2580. Salmonella sp. 32120201201700237FB-01-SM-01 tRNA-Sec
    2581. Salmonella sp. 32120202201500105SM tRNA-Sec
    2582. Salmonella sp. 32120202201500174SM tRNA-Sec
    2583. Salmonella sp. 32120202201600072SM tRNA-Sec
    2584. Salmonella sp. 32120202201600097SM tRNA-Sec
    2585. Salmonella sp. 32120202201600158SM tRNA-Sec
    2586. Salmonella sp. 32120203201500024SM tRNA-Sec
    2587. Salmonella sp. 32120203201700065FB-01-SM-01 tRNA-Sec
    2588. Salmonella sp. 32130201201500050SM tRNA-Sec
    2589. Salmonella sp. 32130201-2017-00038SM tRNA-Sec
    2590. Salmonella sp. 32132402-2017-00107SM tRNA-Sec
    2591. Salmonella sp. 3DZ2-4SM tRNA-Sec
    2592. Salmonella sp. D5-9891 tRNA-Sec
    2593. Salmonella sp. gx-f7 tRNA-Sec
    2594. Salmonella sp. gx-f9 tRNA-Sec
    2595. Salmonella sp. HMSC13B08 tRNA-Sec
    2596. Salmonella sp. hn-f5 tRNA-Sec
    2597. Salmonella sp. hn-h2 tRNA-Sec
    2598. Salmonella sp. hn-h4 tRNA-Sec
    2599. Salmonella sp. HNK130 tRNA-Sec
    2600. Salmonella sp. JS051105201500009SM tRNA-Sec
    2601. Salmonella sp. NCTC 7297 tRNA-seC(tca)
    2602. Salmonella sp. S13 tRNA-Sec
    2603. Salmonella sp. SAL-007 tRNA-Sec
    2604. Salmonella sp. SAL-020 tRNA-Sec
    2605. Salmonella sp. SAL-045 tRNA-Sec
    2606. Salmonella sp. SCFS4 tRNA-Sec
    2607. Salmonella sp. sc-h43 tRNA-Sec
    2608. Salmonella sp. SJTUF14076 tRNA-Sec
    2609. Salmonella sp. SJTUF14146 tRNA-Sec
    2610. Salmonella sp. SJTUF14152 tRNA-Sec
    2611. Salmonella sp. SJTUF14154 tRNA-Sec
    2612. Salmonella sp. SJTUF14170 tRNA-Sec
    2613. Salmonella sp. SJTUF14178 tRNA-Sec
    2614. Salmonella sp. SJTUF14523 tRNA-Sec
    2615. Salmonella sp. SJTUF15034 tRNA-Sec
    2616. Salmonella sp. SSDFZ54 tRNA-Sec
    2617. Salmonella sp. SSDFZ69 tRNA-Sec
    2618. Salmonella sp. XN2 tRNA-Sec
    2619. Salmonella sp. zj-f100 tRNA-Sec
    2620. Salmonella sp. zj-f50 tRNA-Sec
    2621. Salmonella sp. zj-f54 tRNA-Sec
    2622. Salmonella sp. zj-f60 tRNA-Sec
    2623. Salmonella sp. zj-f78 tRNA-Sec
    2624. Salmonella sp. zj-f95 tRNA-Sec
    2625. Shigella boydii tRNA-Sec
    2626. Shigella dysenteriae 1012 tRNA-Sec
    2627. Shigella dysenteriae 1617 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2628. Shigella dysenteriae Sd197 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2629. Shigella dysenteriae tRNA-seC(tca)
    2630. Shigella flexneri 1a tRNA-Sec
    2631. Shigella flexneri 1b tRNA-Sec
    2632. Shigella flexneri 1c tRNA-Sec
    2633. Shigella flexneri 2002017 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2634. Shigella flexneri 2003036 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2635. Shigella flexneri 2a str. 2457T tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2636. Shigella flexneri 2a str. 301 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2637. Shigella flexneri 2a tRNA-seC(tca)
    2638. Shigella flexneri 2b tRNA-seC(tca)
    2639. Shigella flexneri 3a tRNA-Sec
    2640. Shigella flexneri 3b tRNA-Sec
    2641. Shigella flexneri 4c tRNA-Sec
    2642. Shigella flexneri 5a str. M90T tRNA-Sec
    2643. Shigella flexneri 5 str. 8401 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2644. Shigella flexneri G1663 tRNA-Sec
    2645. Shigella flexneri Shi06HN006 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2646. Shigella flexneri tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2647. Shigella flexneri Y tRNA-Sec
    2648. Shigella sonnei 53G tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2649. Shigella sonnei Ss046 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2650. Shigella sonnei tRNA-seC(tca)
    2651. Shigella sp. FC1139 tRNA-Sec
    2652. Shigella sp. FC1172 tRNA-Sec
    2653. Shigella sp. FC1180 tRNA-Sec
    2654. Shigella sp. FC2045 tRNA-Sec
    2655. Shigella sp. FC2928 tRNA-Sec
    2656. Shigella sp. FC569 tRNA-Sec
    2657. Shigella sp. PAMC 28760 tRNA-Sec
    2658. Shigella sp. tRNA-Sec
    2659. Streptococcus pneumoniae tRNA-seC(tca)
    2660. synthetic Escherichia coli C321.deltaA tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
    2661. Trabulsiella guamensis ATCC 49490 tRNA-Sec
    2662. Trabulsiella odontotermitis tRNA-Sec
    2663. Vibrio parahaemolyticus tRNA-Sec
    2664. Xanthomonas citri pv. citri tRNA-Sec
    2665. Yokenella regensburgei ATCC 49455 tRNA-Sec
    2666. Yokenella regensburgei tRNA-seC(tca)
    2D structure Publications New