Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Escherichia coli str. K-12 substr. MG1655 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1) secondary structure diagram

Escherichia coli str. K-12 substr. MG1655 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1) URS00002F9CDD_511145

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAAGAUCGUCGUCUCCGGUGAGGCGGCUGGACUUCAAAUCCAGUUGGGGCCGCCAGCGGUCCCGGGCAGGUUCGACUCCUGUGAUCUUCCGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2,838 other species

  1. Escherichia coli tRNA-seC(tca)
  2. Aerococcus urinaeequi tRNA-Sec
  3. Alistipes onderdonkii tRNA-Sec
  4. bacteria symbiont BFo1 of Frankliniella occidentalis tRNA-Sec
  5. Bacteroides thetaiotaomicron tRNA-Sec
  6. Bifidobacterium adolescentis tRNA-Sec
  7. Bifidobacterium longum tRNA-Sec
  8. Citrobacter amalonaticus tRNA-SeC
  9. Citrobacter amalonaticus Y19 tRNA-Sec
  10. Citrobacter farmeri tRNA-Sec
  11. Citrobacter freundii complex sp. CFNIH2 tRNA-Sec
  12. Citrobacter freundii tRNA-Sec
  13. Citrobacter koseri ATCC BAA-895 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  14. Citrobacter koseri tRNA-SeC
  15. Citrobacter rodentium ICC168 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  16. Citrobacter rodentium tRNA-Sec
  17. Citrobacter sedlakii tRNA-Sec
  18. Citrobacter sp. 50677481 tRNA-Sec
  19. Citrobacter sp. Ca225 tRNA-Sec
  20. Citrobacter sp. Ca226 tRNA-Sec
  21. Citrobacter sp. CK180 tRNA-Sec
  22. Citrobacter sp. CK181 tRNA-Sec
  23. Citrobacter sp. CK182 tRNA-Sec
  24. Citrobacter sp. CK183 tRNA-Sec
  25. Citrobacter sp. CK184 tRNA-Sec
  26. Citrobacter sp. CK185 tRNA-Sec
  27. Citrobacter sp. CK186 tRNA-Sec
  28. Citrobacter sp. CK187 tRNA-Sec
  29. Citrobacter sp. CK188 tRNA-Sec
  30. Citrobacter sp. CK189 tRNA-Sec
  31. Citrobacter sp. CK190 tRNA-Sec
  32. Citrobacter sp. CK191 tRNA-Sec
  33. Citrobacter sp. CK192 tRNA-Sec
  34. Citrobacter sp. CK193 tRNA-Sec
  35. Citrobacter sp. CK194 tRNA-Sec
  36. Citrobacter sp. CK195 tRNA-Sec
  37. Citrobacter sp. CK196 tRNA-Sec
  38. Citrobacter sp. CK197 tRNA-Sec
  39. Citrobacter sp. CK198 tRNA-Sec
  40. Citrobacter sp. CK199 tRNA-Sec
  41. Citrobacter sp. CK200 tRNA-Sec
  42. Citrobacter sp. CK201 tRNA-Sec
  43. Citrobacter sp. CK202 tRNA-Sec
  44. Citrobacter sp. CK203 tRNA-Sec
  45. Citrobacter sp. CK204 tRNA-Sec
  46. Citrobacter sp. CK205 tRNA-Sec
  47. Citrobacter sp. CK206 tRNA-Sec
  48. Citrobacter sp. CK207 tRNA-Sec
  49. Citrobacter sp. Cs237 tRNA-Sec
  50. Citrobacter sp. Ct235 tRNA-Sec
  51. Citrobacter telavivensis tRNA-Sec
  52. Citrobacter sp. RHB20-C15 tRNA-Sec
  53. Citrobacter sp. RHB20-C16 tRNA-Sec
  54. Citrobacter sp. RHB21-C01 tRNA-Sec
  55. Citrobacter sp. RHB21-C05 tRNA-Sec
  56. Citrobacter sp. RHB35-C17 tRNA-Sec
  57. Citrobacter sp. T1.2D-1 tRNA-SeC(tca)
  58. Citrobacter sp. TBCP-5362 tRNA-Sec
  59. Citrobacter sp. tRNA-Sec
  60. Citrobacter sp. Y3 tRNA-Sec
  61. Citrobacter telavivensis tRNA-Sec
  62. Cronobacter condimenti 1330 tRNA-Sec
  63. Cronobacter malonaticus ENBT0334 tRNA-Sec
  64. Cronobacter malonaticus LMG 23826 tRNA-Sec
  65. Cronobacter malonaticus tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  66. Cronobacter sakazakii ATCC BAA-894 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  67. Cronobacter sakazakii ES15 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  68. Cronobacter sakazakii SP291 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  69. Cronobacter sakazakii tRNA-Sec
  70. Cronobacter turicensis tRNA-Sec
  71. Cronobacter turicensis z3032 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  72. Cronobacter universalis NCTC 9529 tRNA-Sec
  73. Cronobacter universalis tRNA-seC(tca)
  74. Culicoides impunctatus tRNA-SeC(tca)
  75. Edwardsiella hoshinae tRNA-seC(tca)
  76. Edwardsiella tarda ATCC 15947 = NBRC 105688 tRNA-Sec
  77. Edwardsiella tarda tRNA-Sec
  78. Enterobacter hormaechei tRNA-Sec
  79. Enterobacteriaceae bacterium 8376wD7 tRNA-Sec
  80. Enterobacteriaceae bacterium 8376wD8 tRNA-Sec
  81. Enterobacteriaceae bacterium 8376wD9 tRNA-Sec
  82. Enterobacteriaceae bacterium 8376wG6 tRNA-Sec
  83. Enterobacteriaceae bacterium 8376wH8 tRNA-Sec
  84. Enterobacteriaceae bacterium BIT-l23 tRNA-Sec
  85. Enterobacteriaceae bacterium tRNA-Sec
  86. Enterobacteriaceae bacterium TzEc013 tRNA-Sec
  87. Enterobacteriaceae bacterium TzEc051 tRNA-Sec
  88. Enterobacteriaceae bacterium TzEc058 tRNA-Sec
  89. Enterobacteriaceae bacterium TzEc077 tRNA-Sec
  90. Enterobacteriaceae bacterium TzEc084 tRNA-Sec
  91. Enterobacter sp. EC-NT1 tRNA-Sec
  92. Erwinia aphidicola tRNA-Sec
  93. Erwinia persicina (Phytophthora infestans metagenome) tRNA-Sec
  94. Erwinia sp. CPCC 100877 tRNA-Sec
  95. Erwinia sorbitola tRNA-Sec
  96. Erwinia sorbitola tRNA-Sec
  97. Erwinia sp. S38 tRNA-Sec
  98. Escherichia alba tRNA-Sec
  99. Escherichia albertii KF1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  100. Escherichia albertii tRNA-Sec
  101. Escherichia albertii TW07627 tRNA-Sec
  102. Escherichia coli 042 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  103. Escherichia coli 101-1 tRNA-Sec
  104. Escherichia coli 1303 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  105. Escherichia coli 53638 tRNA-Sec
  106. Escherichia coli 536 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  107. Escherichia coli 541-15 tRNA-Sec
  108. Escherichia coli 541-1 tRNA-Sec
  109. Escherichia coli 55989 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  110. Escherichia coli 75 tRNA-Sec
  111. Escherichia coli 95JB1 tRNA-Sec
  112. Escherichia coli 95NR1 tRNA-Sec
  113. Escherichia coli ABU 83972 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  114. Escherichia coli APEC O18 tRNA-Sec
  115. Escherichia coli APEC O1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  116. Escherichia coli APEC O2-211 tRNA-Sec
  117. Escherichia coli APEC O2 tRNA-Sec
  118. Escherichia coli APEC O78 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  119. Escherichia coli ATCC 25922 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  120. Escherichia coli ATCC 35150 tRNA-Sec
  121. Escherichia coli ATCC 8739 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  122. Escherichia coli ATCC BAA-2192 tRNA-Sec
  123. Escherichia coli ATCC BAA-2193 tRNA-Sec
  124. Escherichia coli ATCC BAA-2196 tRNA-Sec
  125. Escherichia coli ATCC BAA-2209 tRNA-Sec
  126. Escherichia coli ATCC BAA-2215 tRNA-Sec
  127. Escherichia coli ATCC BAA-2219 tRNA-Sec
  128. Escherichia coli B171 tRNA-Sec
  129. Escherichia coli B7A tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  130. Escherichia coli BL21(DE3) tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  131. Escherichia coli 'BL21-Gold(DE3)pLysS AG' tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  132. Escherichia coli BL21 tRNA-Sec
  133. Escherichia coli B str. REL606 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  134. Escherichia coli B tRNA-Sec
  135. Escherichia coli BW25113 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  136. Escherichia coli BW2952 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  137. Escherichia coli C691-71 (14b) tRNA-Sec
  138. Escherichia coli CFT073 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  139. Escherichia coli C tRNA-Sec
  140. Escherichia coli CUMT8 tRNA-Sec
  141. Escherichia coli DH1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  142. Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 tRNA-Sec
  143. Escherichia coli E1140 tRNA-Sec
  144. Escherichia coli E1728 tRNA-Sec
  145. Escherichia coli E22 tRNA-Sec
  146. Escherichia coli ECA-0157 tRNA-Sec
  147. Escherichia coli ECA-727 tRNA-Sec
  148. Escherichia coli ECC-1470 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  149. Escherichia coli ED1a tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  150. Escherichia coli ER2796 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  151. Escherichia coli ETEC H10407 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  152. Escherichia coli F11 tRNA-Sec
  153. Escherichia coli FAP1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  154. Escherichia coli H19 tRNA-Sec
  155. Escherichia coli H20 tRNA-Sec
  156. Escherichia coli H8 tRNA-Sec
  157. Escherichia coli HM605 tRNA-Sec
  158. Escherichia coli HS tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  159. Escherichia coli HT115 tRNA-Sec
  160. Escherichia coli HVH 101 (4-6859844) tRNA-Sec
  161. Escherichia coli HVH 54 (4-2723514) tRNA-Sec
  162. Escherichia coli HVH 93 (4-5851025) tRNA-Sec
  163. Escherichia coli IAI1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  164. Escherichia coli IAI39 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  165. Escherichia coli IHE3034 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  166. Escherichia coli J96 tRNA-Sec
  167. Escherichia coli JJ1886 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  168. Escherichia coli JJ1887 tRNA-Sec
  169. Escherichia coli K-12 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  170. Escherichia coli K71 tRNA-Sec
  171. Escherichia coli KLY tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  172. Escherichia coli KO11FL tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  173. Escherichia coli LAU-EC10 tRNA-Sec
  174. Escherichia coli LAU-EC6 tRNA-Sec
  175. Escherichia coli LAU-EC7 tRNA-Sec
  176. Escherichia coli LAU-EC8 tRNA-Sec
  177. Escherichia coli LAU-EC9 tRNA-Sec
  178. Escherichia coli LF82 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  179. Escherichia coli LY180 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  180. Escherichia coli M12 tRNA-Sec
  181. Escherichia coli M4 tRNA-Sec
  182. Escherichia coli M8 tRNA-Sec
  183. Escherichia coli MP1 tRNA-Sec
  184. Escherichia coli MRSN 10204 tRNA-Sec
  185. Escherichia coli N36254PS tRNA-Sec
  186. Escherichia coli N36410PS tRNA-Sec
  187. Escherichia coli N37058PS tRNA-Sec
  188. Escherichia coli N37122PS tRNA-Sec
  189. Escherichia coli N37139PS tRNA-Sec
  190. Escherichia coli N40513 tRNA-Sec
  191. Escherichia coli N40607 tRNA-Sec
  192. Escherichia coli NA114 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  193. Escherichia coli NB8 tRNA-Sec
  194. Escherichia coli NC101 tRNA-Sec
  195. Escherichia coli NCTC 50110 tRNA-Sec
  196. Escherichia coli Nissle 1917 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  197. Escherichia coli NU14 tRNA-Sec
  198. Escherichia coli O100:H12 tRNA-Sec
  199. Escherichia coli O100:H21 tRNA-Sec
  200. Escherichia coli O100 tRNA-Sec
  201. Escherichia coli O101 tRNA-Sec
  202. Escherichia coli O102:H6 tRNA-Sec
  203. Escherichia coli O102 tRNA-Sec
  204. Escherichia coli O103:H11 str. 04-3023 tRNA-Sec
  205. Escherichia coli O103:H11 str. 2010C-3214 tRNA-Sec
  206. Escherichia coli O103:H25 str. 2010C-4529 tRNA-Sec
  207. Escherichia coli O103:H25 str. CVM9340 tRNA-Sec
  208. Escherichia coli O103:H2 str. 12009 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  209. Escherichia coli O103:H2 str. 2009C-3279 tRNA-Sec
  210. Escherichia coli O103:H2 str. 2010C-4433 tRNA-Sec
  211. Escherichia coli O103:H2 str. 2011C-3750 tRNA-Sec
  212. Escherichia coli O103:H2 str. CVM9450 tRNA-Sec
  213. Escherichia coli O103:H2 tRNA-Sec
  214. Escherichia coli O103 str. RM8385 tRNA-Sec
  215. Escherichia coli O103 tRNA-Sec
  216. Escherichia coli O104:H21 str. 94-3025 tRNA-Sec
  217. Escherichia coli O104:H21 str. CFSAN002236 tRNA-Sec
  218. Escherichia coli O104:H21 str. CFSAN002237 tRNA-Sec
  219. Escherichia coli O104:H4 str. 2009EL-2050 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  220. Escherichia coli O104:H4 str. 2009EL-2071 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  221. Escherichia coli O104:H4 str. 2011C-3493 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  222. Escherichia coli O104:H4 str. 2011EL-1675A tRNA-Sec
  223. Escherichia coli O104:H4 str. C227-11 tRNA-Sec
  224. Escherichia coli O104:H4 tRNA-Sec
  225. Escherichia coli O104 tRNA-Sec
  226. Escherichia coli O105 tRNA-Sec
  227. Escherichia coli O106 tRNA-Sec
  228. Escherichia coli O107 tRNA-Sec
  229. Escherichia coli O108:H9 tRNA-Sec
  230. Escherichia coli O109 tRNA-Sec
  231. Escherichia coli O10:H32 tRNA-Sec
  232. Escherichia coli O10 tRNA-Sec
  233. Escherichia coli O110 tRNA-Sec
  234. Escherichia coli O111:H8 str. 2009C-4126 tRNA-Sec
  235. Escherichia coli O111:H8 str. 2009EL-2169 tRNA-Sec
  236. Escherichia coli O111:H8 str. 2011C-3453 tRNA-Sec
  237. Escherichia coli O111:H8 str. CFSAN001632 tRNA-Sec
  238. Escherichia coli O111:H8 str. CVM9570 tRNA-Sec
  239. Escherichia coli O111:H8 str. CVM9574 tRNA-Sec
  240. Escherichia coli O111:H8 str. CVM9602 tRNA-Sec
  241. Escherichia coli O111:H8 str. CVM9634 tRNA-Sec
  242. Escherichia coli O111:H8 str. F6627 tRNA-Sec
  243. Escherichia coli O111:H8 tRNA-Sec
  244. Escherichia coli O111:H- str. 11128 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  245. Escherichia coli O111:H- tRNA-Sec
  246. Escherichia coli O111:NM str. 01-3076 tRNA-Sec
  247. Escherichia coli O111:NM str. 03-3484 tRNA-Sec
  248. Escherichia coli O111:NM str. 04-3211 tRNA-Sec
  249. Escherichia coli O111:NM str. 08-4487 tRNA-Sec
  250. Escherichia coli O111:NM str. 2009C-4006 tRNA-Sec
  251. Escherichia coli O111:NM str. 2009C-4052 tRNA-Sec
  252. Escherichia coli O111:NM str. 2010C-3053 tRNA-Sec
  253. Escherichia coli O111:NM str. 2010C-3977 tRNA-Sec
  254. Escherichia coli O111:NM str. 2010C-4086 tRNA-Sec
  255. Escherichia coli O111:NM str. 2010C-4221 tRNA-Sec
  256. Escherichia coli O111:NM str. 2010C-4592 tRNA-Sec
  257. Escherichia coli O111:NM str. 2010C-4622 tRNA-Sec
  258. Escherichia coli O111:NM str. 2010C-4715 tRNA-Sec
  259. Escherichia coli O111:NM str. 2010C-4735 tRNA-Sec
  260. Escherichia coli O111:NM str. 2010C-4746 tRNA-Sec
  261. Escherichia coli O111:NM str. 2010C-4799 tRNA-Sec
  262. Escherichia coli O111:NM str. 2010C-4818 tRNA-Sec
  263. Escherichia coli O111:NM str. 2011C-3170 tRNA-Sec
  264. Escherichia coli O111:NM str. 2011C-3362 tRNA-Sec
  265. Escherichia coli O111:NM str. 2011C-3573 tRNA-Sec
  266. Escherichia coli O111:NM str. 2011C-3632 tRNA-Sec
  267. Escherichia coli O111:NM str. 2011C-3679 tRNA-Sec
  268. Escherichia coli O111:NM str. K6722 tRNA-Sec
  269. Escherichia coli O111:NM str. K6723 tRNA-Sec
  270. Escherichia coli O111:NM str. K6728 tRNA-Sec
  271. Escherichia coli O111:NM str. K6890 tRNA-Sec
  272. Escherichia coli O111:NM str. K6895 tRNA-Sec
  273. Escherichia coli O111:NM str. K6897 tRNA-Sec
  274. Escherichia coli O111:NM str. K6898 tRNA-Sec
  275. Escherichia coli O111:NM str. K6904 tRNA-Sec
  276. Escherichia coli O111:NM str. K6908 tRNA-Sec
  277. Escherichia coli O111:NM str. K6915 tRNA-Sec
  278. Escherichia coli O111:NM tRNA-Sec
  279. Escherichia coli O111 str. RM9322 tRNA-Sec
  280. Escherichia coli O111 tRNA-Sec
  281. Escherichia coli O112ab:H8 tRNA-Sec
  282. Escherichia coli O113:H21 str. 07-4224 tRNA-Sec
  283. Escherichia coli O113:H21 tRNA-Sec
  284. Escherichia coli O113:H36 tRNA-Sec
  285. Escherichia coli O113 tRNA-Sec
  286. Escherichia coli O117 tRNA-Sec
  287. Escherichia coli O118:H16 str. 06-3256 tRNA-Sec
  288. Escherichia coli O118:H16 str. 06-3612 tRNA-Sec
  289. Escherichia coli O118:H16 str. 07-4255 tRNA-Sec
  290. Escherichia coli O118:H16 str. 08-3651 tRNA-Sec
  291. Escherichia coli O118:H16 str. 2009C-4446 tRNA-Sec
  292. Escherichia coli O119:H4 str. 03-3458 tRNA-Sec
  293. Escherichia coli O119 tRNA-Sec
  294. Escherichia coli O11:H15 tRNA-Sec
  295. Escherichia coli O11 tRNA-Sec
  296. Escherichia coli O120:H10 tRNA-Sec
  297. Escherichia coli O121:H19 str. 03-3227 tRNA-Sec
  298. Escherichia coli O121:H19 str. 06-3003 tRNA-Sec
  299. Escherichia coli O121:H19 str. 06-3822 tRNA-Sec
  300. Escherichia coli O121:H19 str. 2009C-4050 tRNA-Sec
  301. Escherichia coli O121:H19 str. 2009C-4659 tRNA-Sec
  302. Escherichia coli O121:H19 str. 2009C-4750 tRNA-Sec
  303. Escherichia coli O121:H19 str. 2009EL1302 tRNA-Sec
  304. Escherichia coli O121:H19 str. 2009EL1412 tRNA-Sec
  305. Escherichia coli O121:H19 str. 2010C-3609 tRNA-Sec
  306. Escherichia coli O121:H19 str. 2010C-3794 tRNA-Sec
  307. Escherichia coli O121:H19 str. 2010C-3840 tRNA-Sec
  308. Escherichia coli O121:H19 str. 2010C-4254 tRNA-Sec
  309. Escherichia coli O121:H19 str. 2010C-4732 tRNA-Sec
  310. Escherichia coli O121:H19 str. 2010C-4824 tRNA-Sec
  311. Escherichia coli O121:H19 str. 2010C-4966 tRNA-Sec
  312. Escherichia coli O121:H19 str. 2010C-4989 tRNA-Sec
  313. Escherichia coli O121:H19 str. 2010EL1058 tRNA-Sec
  314. Escherichia coli O121:H19 str. 2011C-3072 tRNA-Sec
  315. Escherichia coli O121:H19 str. 2011C-3108 tRNA-Sec
  316. Escherichia coli O121:H19 str. 2011C-3216 tRNA-Sec
  317. Escherichia coli O121:H19 str. 2011C-3500 tRNA-Sec
  318. Escherichia coli O121:H19 str. 2011C-3537 tRNA-Sec
  319. Escherichia coli O121:H19 str. 2011C-3609 tRNA-Sec
  320. Escherichia coli O121:H19 str. F6714 tRNA-Sec
  321. Escherichia coli O121:H19 str. K5198 tRNA-Sec
  322. Escherichia coli O121:H19 str. K5269 tRNA-Sec
  323. Escherichia coli O121:H19 tRNA-Sec
  324. Escherichia coli O121:H7 str. 2009C-3299 tRNA-Sec
  325. Escherichia coli O121 str. RM8352 tRNA-Sec
  326. Escherichia coli O121 tRNA-Sec
  327. Escherichia coli O123:H11 str. 2009C-3307 tRNA-Sec
  328. Escherichia coli O124 tRNA-Sec
  329. Escherichia coli O125ac:K+:H10 tRNA-Sec
  330. Escherichia coli O126:H45 tRNA-Sec
  331. Escherichia coli O126 tRNA-Sec
  332. Escherichia coli O127:H6 str. E2348/69 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  333. Escherichia coli O128ac:H12 tRNA-Sec
  334. Escherichia coli O128:H2 str. 2011C-3317 tRNA-Sec
  335. Escherichia coli O128:H42 tRNA-Sec
  336. Escherichia coli O128 tRNA-Sec
  337. Escherichia coli O130 tRNA-Sec
  338. Escherichia coli O132 tRNA-Sec
  339. Escherichia coli O136:H26 tRNA-Sec
  340. Escherichia coli O139:H1 tRNA-Sec
  341. Escherichia coli O139:H28 str. E24377A tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  342. Escherichia coli O13 tRNA-Sec
  343. Escherichia coli O140 tRNA-Sec
  344. Escherichia coli O141:H4 tRNA-Sec
  345. Escherichia coli O143:H4 tRNA-Sec
  346. Escherichia coli O144 tRNA-Sec
  347. Escherichia coli O145:H25 str. 07-3858 tRNA-Sec
  348. Escherichia coli O145:H25 tRNA-Sec
  349. Escherichia coli O145:H28 str. 2009C-3292 tRNA-Sec
  350. Escherichia coli O145:H28 str. 4865/96 tRNA-Sec
  351. Escherichia coli O145:H28 str. RM12581 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  352. Escherichia coli O145:H28 str. RM12761 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  353. Escherichia coli O145:H28 str. RM13514 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  354. Escherichia coli O145:H28 str. RM13516 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  355. Escherichia coli O145:H28 tRNA-Sec
  356. Escherichia coli O145:H34 tRNA-Sec
  357. Escherichia coli O145:NM str. 06-3484 tRNA-Sec
  358. Escherichia coli O145:NM str. 08-4270 tRNA-Sec
  359. Escherichia coli O145:NM str. 2010C-3507 tRNA-Sec
  360. Escherichia coli O145:NM str. 2010C-3508 tRNA-Sec
  361. Escherichia coli O145:NM str. 2010C-3509 tRNA-Sec
  362. Escherichia coli O145:NM str. 2010C-3510 tRNA-Sec
  363. Escherichia coli O145:NM str. 2010C-3511 tRNA-Sec
  364. Escherichia coli O145:NM str. 2010C-3516 tRNA-Sec
  365. Escherichia coli O145:NM str. 2010C-3517 tRNA-Sec
  366. Escherichia coli O145:NM str. 2010C-3518 tRNA-Sec
  367. Escherichia coli O145:NM str. 2010C-3521 tRNA-Sec
  368. Escherichia coli O145:NM str. 2010C-3526 tRNA-Sec
  369. Escherichia coli O145:NM str. 2010C-4557C2 tRNA-Sec
  370. Escherichia coli O145:NM tRNA-Sec
  371. Escherichia coli O145 str. RM9872 tRNA-Sec
  372. Escherichia coli O145 tRNA-Sec
  373. Escherichia coli O146:H21 str. 2010C-3325 tRNA-Sec
  374. Escherichia coli O146 tRNA-Sec
  375. Escherichia coli O14 tRNA-Sec
  376. Escherichia coli O150:H6 tRNA-Sec
  377. Escherichia coli O150 tRNA-Sec
  378. Escherichia coli O151:H8 tRNA-Sec
  379. Escherichia coli O152:H23 tRNA-Sec
  380. Escherichia coli O153:H12 tRNA-Sec
  381. Escherichia coli O153:H2 str. 2010C-5034 tRNA-Sec
  382. Escherichia coli O153 tRNA-Sec
  383. Escherichia coli O155:H21 tRNA-Sec
  384. Escherichia coli O155 tRNA-Sec
  385. Escherichia coli O156:H25 str. 2011C-3602 tRNA-Sec
  386. Escherichia coli O157:H16 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  387. Escherichia coli O157:H43 tRNA-Sec
  388. Escherichia coli O157:H7 str. 06-3745 tRNA-Sec
  389. Escherichia coli O157:H7 str. 06-4039 tRNA-Sec
  390. Escherichia coli O157:H7 str. 07-3091 tRNA-Sec
  391. Escherichia coli O157:H7 str. 07-3391 tRNA-Sec
  392. Escherichia coli O157:H7 str. 08-3037 tRNA-Sec
  393. Escherichia coli O157:H7 str. 08-3527 tRNA-Sec
  394. Escherichia coli O157:H7 str. 08-4169 tRNA-Sec
  395. Escherichia coli O157:H7 str. 08-4529 tRNA-Sec
  396. Escherichia coli O157:H7 str. 2009C-4258 tRNA-Sec
  397. Escherichia coli O157:H7 str. 2009EL1449 tRNA-Sec
  398. Escherichia coli O157:H7 str. 2009EL1705 tRNA-Sec
  399. Escherichia coli O157:H7 str. 2009EL1913 tRNA-Sec
  400. Escherichia coli O157:H7 str. 2009EL2109 tRNA-Sec
  401. Escherichia coli O157:H7 str. 2010C-4979C1 tRNA-Sec
  402. Escherichia coli O157:H7 str. 2011EL-1107 tRNA-Sec
  403. Escherichia coli O157:H7 str. 2011EL-2090 tRNA-Sec
  404. Escherichia coli O157:H7 str. 2011EL-2091 tRNA-Sec
  405. Escherichia coli O157:H7 str. 2011EL-2092 tRNA-Sec
  406. Escherichia coli O157:H7 str. 2011EL-2093 tRNA-Sec
  407. Escherichia coli O157:H7 str. 2011EL-2094 tRNA-Sec
  408. Escherichia coli O157:H7 str. 2011EL-2096 tRNA-Sec
  409. Escherichia coli O157:H7 str. 2011EL-2097 tRNA-Sec
  410. Escherichia coli O157:H7 str. 2011EL-2098 tRNA-Sec
  411. Escherichia coli O157:H7 str. 2011EL-2099 tRNA-Sec
  412. Escherichia coli O157:H7 str. 2011EL-2101 tRNA-Sec
  413. Escherichia coli O157:H7 str. 2011EL-2103 tRNA-Sec
  414. Escherichia coli O157:H7 str. 2011EL-2104 tRNA-Sec
  415. Escherichia coli O157:H7 str. 2011EL-2105 tRNA-Sec
  416. Escherichia coli O157:H7 str. 2011EL-2106 tRNA-Sec
  417. Escherichia coli O157:H7 str. 2011EL-2107 tRNA-Sec
  418. Escherichia coli O157:H7 str. 2011EL-2108 tRNA-Sec
  419. Escherichia coli O157:H7 str. 2011EL-2109 tRNA-Sec
  420. Escherichia coli O157:H7 str. 2011EL-2111 tRNA-Sec
  421. Escherichia coli O157:H7 str. 2011EL-2112 tRNA-Sec
  422. Escherichia coli O157:H7 str. 2011EL-2113 tRNA-Sec
  423. Escherichia coli O157:H7 str. 2011EL-2114 tRNA-Sec
  424. Escherichia coli O157:H7 str. 2011EL-2286 tRNA-Sec
  425. Escherichia coli O157:H7 str. 2011EL-2287 tRNA-Sec
  426. Escherichia coli O157:H7 str. 2011EL-2288 tRNA-Sec
  427. Escherichia coli O157:H7 str. 2011EL-2289 tRNA-Sec
  428. Escherichia coli O157:H7 str. 2011EL-2290 tRNA-Sec
  429. Escherichia coli O157:H7 str. 2011EL-2312 tRNA-Sec
  430. Escherichia coli O157:H7 str. 2011EL-2313 tRNA-Sec
  431. Escherichia coli O157:H7 str. EC10 tRNA-Sec
  432. Escherichia coli O157:H7 str. EC1825 tRNA-Sec
  433. Escherichia coli O157:H7 str. EC4042 tRNA-Sec
  434. Escherichia coli O157:H7 str. EC4045 tRNA-Sec
  435. Escherichia coli O157:H7 str. EC4076 tRNA-Sec
  436. Escherichia coli O157:H7 str. EC4113 tRNA-Sec
  437. Escherichia coli O157:H7 str. EC4115 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  438. Escherichia coli O157:H7 str. EC4196 tRNA-Sec
  439. Escherichia coli O157:H7 str. EC4206 tRNA-Sec
  440. Escherichia coli O157:H7 str. EC4401 tRNA-Sec
  441. Escherichia coli O157:H7 str. EC4486 tRNA-Sec
  442. Escherichia coli O157:H7 str. EC4501 tRNA-Sec
  443. Escherichia coli O157:H7 str. EC508 tRNA-Sec
  444. Escherichia coli O157:H7 str. EC869 tRNA-Sec
  445. Escherichia coli O157:H7 str. EDL933 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  446. Escherichia coli O157:H7 str. F6142 tRNA-Sec
  447. Escherichia coli O157:H7 str. F6749 tRNA-Sec
  448. Escherichia coli O157:H7 str. F6750 tRNA-Sec
  449. Escherichia coli O157:H7 str. F6751 tRNA-Sec
  450. Escherichia coli O157:H7 str. F7350 tRNA-Sec
  451. Escherichia coli O157:H7 str. F7377 tRNA-Sec
  452. Escherichia coli O157:H7 str. F7384 tRNA-Sec
  453. Escherichia coli O157:H7 str. F7410 tRNA-Sec
  454. Escherichia coli O157:H7 str. F8092B tRNA-Sec
  455. Escherichia coli O157:H7 str. G5101 tRNA-Sec
  456. Escherichia coli O157:H7 str. G5303 tRNA-Sec
  457. Escherichia coli O157:H7 str. H2495 tRNA-Sec
  458. Escherichia coli O157:H7 str. H2498 tRNA-Sec
  459. Escherichia coli O157:H7 str. K1420 tRNA-Sec
  460. Escherichia coli O157:H7 str. K1792 tRNA-Sec
  461. Escherichia coli O157:H7 str. K1793 tRNA-Sec
  462. Escherichia coli O157:H7 str. K1795 tRNA-Sec
  463. Escherichia coli O157:H7 str. K1796 tRNA-Sec
  464. Escherichia coli O157:H7 str. K1845 tRNA-Sec
  465. Escherichia coli O157:H7 str. K1921 tRNA-Sec
  466. Escherichia coli O157:H7 str. K1927 tRNA-Sec
  467. Escherichia coli O157:H7 str. K2188 tRNA-Sec
  468. Escherichia coli O157:H7 str. K2191 tRNA-Sec
  469. Escherichia coli O157:H7 str. K2192 tRNA-Sec
  470. Escherichia coli O157:H7 str. K2324 tRNA-Sec
  471. Escherichia coli O157:H7 str. K2581 tRNA-Sec
  472. Escherichia coli O157:H7 str. K2622 tRNA-Sec
  473. Escherichia coli O157:H7 str. K2845 tRNA-Sec
  474. Escherichia coli O157:H7 str. K2854 tRNA-Sec
  475. Escherichia coli O157:H7 str. K4396 tRNA-Sec
  476. Escherichia coli O157:H7 str. K4405 tRNA-Sec
  477. Escherichia coli O157:H7 str. K4406 tRNA-Sec
  478. Escherichia coli O157:H7 str. K4527 tRNA-Sec
  479. Escherichia coli O157:H7 str. K5418 tRNA-Sec
  480. Escherichia coli O157:H7 str. K5448 tRNA-Sec
  481. Escherichia coli O157:H7 str. K5449 tRNA-Sec
  482. Escherichia coli O157:H7 str. K5453 tRNA-Sec
  483. Escherichia coli O157:H7 str. K5460 tRNA-Sec
  484. Escherichia coli O157:H7 str. K5467 tRNA-Sec
  485. Escherichia coli O157:H7 str. K5602 tRNA-Sec
  486. Escherichia coli O157:H7 str. K5607 tRNA-Sec
  487. Escherichia coli O157:H7 str. K5609 tRNA-Sec
  488. Escherichia coli O157:H7 str. K5806 tRNA-Sec
  489. Escherichia coli O157:H7 str. K5852 tRNA-Sec
  490. Escherichia coli O157:H7 str. K6590 tRNA-Sec
  491. Escherichia coli O157:H7 str. K6676 tRNA-Sec
  492. Escherichia coli O157:H7 str. K6687 tRNA-Sec
  493. Escherichia coli O157:H7 str. K7140 tRNA-Sec
  494. Escherichia coli O157:H7 str. LSU-61 tRNA-Sec
  495. Escherichia coli O157:H7 str. Sakai tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  496. Escherichia coli O157:H7 str. SS17 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  497. Escherichia coli O157:H7 str. SS52 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  498. Escherichia coli O157:H7 str. TW14313 tRNA-Sec
  499. Escherichia coli O157:H7 str. TW14359 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  500. Escherichia coli O157:H7 str. TW14588 tRNA-Sec
  501. Escherichia coli O157:H7 tRNA-Sec
  502. Escherichia coli O157:H- str. 493-89 tRNA-Sec
  503. Escherichia coli O157:H- str. H 2687 tRNA-Sec
  504. Escherichia coli O157:H- tRNA-Sec
  505. Escherichia coli O157:NM str. 08-4540 tRNA-Sec
  506. Escherichia coli O157:NM tRNA-Sec
  507. Escherichia coli O157: str. 2010EL-2044 tRNA-Sec
  508. Escherichia coli O157: str. 2010EL-2045 tRNA-Sec
  509. Escherichia coli O157 tRNA-Sec
  510. Escherichia coli O158:H23 tRNA-Sec
  511. Escherichia coli O159:H19 tRNA-Sec
  512. Escherichia coli O15:H12 tRNA-Sec
  513. Escherichia coli O15:H18 str. K1516 tRNA-Sec
  514. Escherichia coli O15:H18 tRNA-Sec
  515. Escherichia coli O15:H21 tRNA-Sec
  516. Escherichia coli O15 tRNA-Sec
  517. Escherichia coli O160 tRNA-Sec
  518. Escherichia coli O163 tRNA-Sec
  519. Escherichia coli O165:H25 str. 2010C-4874 tRNA-Sec
  520. Escherichia coli O166:H49 tRNA-Sec
  521. Escherichia coli O166:H6 tRNA-Sec
  522. Escherichia coli O167:H26 tRNA-Sec
  523. Escherichia coli O167:H9 tRNA-Sec
  524. Escherichia coli O168:H8 tRNA-Sec
  525. Escherichia coli O168 tRNA-Sec
  526. Escherichia coli O169:H41 str. F9792 tRNA-Sec
  527. Escherichia coli O16:H48 tRNA-Sec
  528. Escherichia coli O16 tRNA-Sec
  529. Escherichia coli O170:H18 tRNA-Sec
  530. Escherichia coli O170 tRNA-Sec
  531. Escherichia coli O171 tRNA-Sec
  532. Escherichia coli O174:H21 str. 03-3269 tRNA-Sec
  533. Escherichia coli O174:H21 tRNA-Sec
  534. Escherichia coli O174:H7 tRNA-Sec
  535. Escherichia coli O174:H8 str. 04-3038 tRNA-Sec
  536. Escherichia coli O174 tRNA-Sec
  537. Escherichia coli O176:H45 tRNA-Sec
  538. Escherichia coli O177:NM str. 2010C-4558 tRNA-Sec
  539. Escherichia coli O177 tRNA-Sec
  540. Escherichia coli O180:H14 tRNA-Sec
  541. Escherichia coli O18ac:H14 tRNA-Sec
  542. Escherichia coli O18:H1 tRNA-Sec
  543. Escherichia coli O18:H7 tRNA-Sec
  544. Escherichia coli O19:H42 tRNA-Sec
  545. Escherichia coli O19:H7 tRNA-Sec
  546. Escherichia coli O19 tRNA-Sec
  547. Escherichia coli O1:H42 tRNA-Sec
  548. Escherichia coli O1:H7 tRNA-Sec
  549. Escherichia coli O1:HNT tRNA-Sec
  550. Escherichia coli O1 tRNA-Sec
  551. Escherichia coli O20:H12 tRNA-Sec
  552. Escherichia coli O21:H28 tRNA-Sec
  553. Escherichia coli O21 tRNA-Sec
  554. Escherichia coli O22:H8 tRNA-Sec
  555. Escherichia coli O22 tRNA-Sec
  556. Escherichia coli O24 tRNA-Sec
  557. Escherichia coli O25b:H4-ST131 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  558. Escherichia coli O25b:H4 tRNA-Sec
  559. Escherichia coli O25:H4 tRNA-SeC
  560. Escherichia coli O25:NM str. E2539C1 tRNA-Sec
  561. Escherichia coli O25 tRNA-Sec
  562. Escherichia coli O26:H11 str. 03-3500 tRNA-Sec
  563. Escherichia coli O26:H11 str. 05-3646 tRNA-Sec
  564. Escherichia coli O26:H11 str. 06-3464 tRNA-Sec
  565. Escherichia coli O26:H11 str. 11368 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  566. Escherichia coli O26:H11 str. 2009C-3612 tRNA-Sec
  567. Escherichia coli O26:H11 str. 2009C-3689 tRNA-Sec
  568. Escherichia coli O26:H11 str. 2009C-3996 tRNA-Sec
  569. Escherichia coli O26:H11 str. 2009C-4760 tRNA-Sec
  570. Escherichia coli O26:H11 str. 2009C-4826 tRNA-Sec
  571. Escherichia coli O26:H11 str. 2010C-3051 tRNA-Sec
  572. Escherichia coli O26:H11 str. 2010C-3472 tRNA-Sec
  573. Escherichia coli O26:H11 str. 2010C-3871 tRNA-Sec
  574. Escherichia coli O26:H11 str. 2010C-3902 tRNA-Sec
  575. Escherichia coli O26:H11 str. 2010C-4244 tRNA-Sec
  576. Escherichia coli O26:H11 str. 2010C-4430 tRNA-Sec
  577. Escherichia coli O26:H11 str. 2010C-4819 tRNA-Sec
  578. Escherichia coli O26:H11 str. 2010C-4834 tRNA-Sec
  579. Escherichia coli O26:H11 str. 2010C-5028 tRNA-Sec
  580. Escherichia coli O26:H11 str. 2010EL-1699 tRNA-Sec
  581. Escherichia coli O26:H11 str. 2011C-3270 tRNA-Sec
  582. Escherichia coli O26:H11 str. 2011C-3274 tRNA-Sec
  583. Escherichia coli O26:H11 str. 2011C-3282 tRNA-Sec
  584. Escherichia coli O26:H11 str. 2011C-3387 tRNA-Sec
  585. Escherichia coli O26:H11 str. 2011C-3506 tRNA-Sec
  586. Escherichia coli O26:H11 str. 2011C-3655 tRNA-Sec
  587. Escherichia coli O26:H11 str. CVM10021 tRNA-Sec
  588. Escherichia coli O26:H11 str. CVM9952 tRNA-Sec
  589. Escherichia coli O26:H11 tRNA-Sec
  590. Escherichia coli O26:H1 str. 2009C-4747 tRNA-Sec
  591. Escherichia coli O26:NM str. 2010C-4347 tRNA-Sec
  592. Escherichia coli O26:NM str. 2010C-4788 tRNA-Sec
  593. Escherichia coli O26 str. RM10386 tRNA-Sec
  594. Escherichia coli O26 str. RM8426 tRNA-Sec
  595. Escherichia coli O26 tRNA-Sec
  596. Escherichia coli O28ac:NM str. 02-3404 tRNA-Sec
  597. Escherichia coli O2:H14 tRNA-Sec
  598. Escherichia coli O2:H1 tRNA-Sec
  599. Escherichia coli O2:H32 tRNA-Sec
  600. Escherichia coli O2:H6 tRNA-Sec
  601. Escherichia coli O2:K2:H1 tRNA-Sec
  602. Escherichia coli O2 tRNA-Sec
  603. Escherichia coli O32 tRNA-Sec
  604. Escherichia coli O33 tRNA-Sec
  605. Escherichia coli O35 tRNA-Sec
  606. Escherichia coli O36:H5 tRNA-Sec
  607. Escherichia coli O36 tRNA-Sec
  608. Escherichia coli O38:H26 tRNA-Sec
  609. Escherichia coli O39:H21 tRNA-Sec
  610. Escherichia coli O39:H4 tRNA-Sec
  611. Escherichia coli O3 tRNA-Sec
  612. Escherichia coli O40:H32 tRNA-Sec
  613. Escherichia coli O43:H14 tRNA-Sec
  614. Escherichia coli O43:H2 tRNA-Sec
  615. Escherichia coli O43 str. RM10042 tRNA-Sec
  616. Escherichia coli O43 tRNA-Sec
  617. Escherichia coli O45:H2 str. 01-3147 tRNA-Sec
  618. Escherichia coli O45:H2 str. 2009C-3686 tRNA-Sec
  619. Escherichia coli O45:H2 str. 2009C-4780 tRNA-Sec
  620. Escherichia coli O45:H2 str. 2010C-3876 tRNA-Sec
  621. Escherichia coli O45:H2 str. 2010C-4211 tRNA-Sec
  622. Escherichia coli O45:H2 tRNA-Sec
  623. Escherichia coli O49:H9 tRNA-Sec
  624. Escherichia coli O53 tRNA-Sec
  625. Escherichia coli O54 tRNA-Sec
  626. Escherichia coli O55:H7 str. 06-3555 tRNA-Sec
  627. Escherichia coli O55:H7 str. 3256-97 tRNA-Sec
  628. Escherichia coli O55:H7 str. CB9615 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  629. Escherichia coli O55:H7 str. RM12579 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  630. Escherichia coli O55:H7 str. TB182A tRNA-Sec
  631. Escherichia coli O55:H7 str. USDA 5905 tRNA-Sec
  632. Escherichia coli O55:H7 tRNA-Sec
  633. Escherichia coli O55 tRNA-Sec
  634. Escherichia coli O5 tRNA-Sec
  635. Escherichia coli O68:H12 tRNA-Sec
  636. Escherichia coli O69:H11 str. 06-3325 tRNA-Sec
  637. Escherichia coli O69:H11 str. 07-3763 tRNA-Sec
  638. Escherichia coli O69:H11 str. 07-4281 tRNA-Sec
  639. Escherichia coli O69:H11 str. 08-4661 tRNA-Sec
  640. Escherichia coli O69:H11 str. 2009C-3601 tRNA-Sec
  641. Escherichia coli O6:H16:CFA/II str. B2C tRNA-Sec
  642. Escherichia coli O6:H16 str. 99-3165 tRNA-Sec
  643. Escherichia coli O6:H16 str. F5656C1 tRNA-Sec
  644. Escherichia coli O6:H34 tRNA-Sec
  645. Escherichia coli O6:K2:H1 tRNA-Sec
  646. Escherichia coli O6 tRNA-Sec
  647. Escherichia coli O70:H25 tRNA-Sec
  648. Escherichia coli O73 tRNA-Sec
  649. Escherichia coli O74:H8 tRNA-Sec
  650. Escherichia coli O74 tRNA-Sec
  651. Escherichia coli O78:H12 str. 00-3279 tRNA-Sec
  652. Escherichia coli O78:H42 tRNA-Sec
  653. Escherichia coli O78:H4 tRNA-Sec
  654. Escherichia coli O78 tRNA-Sec
  655. Escherichia coli O79:H7 str. 06-3501 tRNA-Sec
  656. Escherichia coli O79 tRNA-Sec
  657. unidentified tRNA-Sec
  658. Escherichia coli O7:H4 tRNA-Sec
  659. Escherichia coli O7:H7 tRNA-Sec
  660. Escherichia coli O7:K1 str. CE10 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  661. Escherichia coli O80:H26 tRNA-Sec
  662. Escherichia coli O80:H45 tRNA-Sec
  663. Escherichia coli O81:NM str. 02-3012 tRNA-Sec
  664. Escherichia coli O82 tRNA-Sec
  665. Escherichia coli O83:H1 str. NRG 857C tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  666. Escherichia coli O83:H31 tRNA-Sec
  667. Escherichia coli O83 tRNA-Sec
  668. Escherichia coli O83w tRNA-Sec
  669. Escherichia coli O84:H7 tRNA-Sec
  670. Escherichia coli O85:H1 tRNA-Sec
  671. Escherichia coli O86:H34 str. 99-3124 tRNA-Sec
  672. Escherichia coli O86:H8 tRNA-Sec
  673. Escherichia coli O88:H1 tRNA-Sec
  674. Escherichia coli O88:H4 tRNA-Sec
  675. Escherichia coli O89m:H10 tRNA-Sec
  676. Escherichia coli O89m:H9 tRNA-Sec
  677. Escherichia coli O8:H10 tRNA-Sec
  678. Escherichia coli O8:H19 tRNA-Sec
  679. Escherichia coli O8:H28 tRNA-Sec
  680. Escherichia coli O8:H31 tRNA-Sec
  681. Escherichia coli O8:H36 tRNA-Sec
  682. Escherichia coli O8:H49 tRNA-Sec
  683. Escherichia coli O8:H8 tRNA-SeC
  684. Escherichia coli O8:H9 tRNA-Sec
  685. Escherichia coli O8 tRNA-Sec
  686. Escherichia coli O91:H14 str. 06-3691 tRNA-Sec
  687. Escherichia coli O91:H14 str. 2009C-3227 tRNA-Sec
  688. Escherichia coli O91:H21 str. 2009C-3740 tRNA-Sec
  689. Escherichia coli O91:H21 str. 2009C-4646 tRNA-Sec
  690. Escherichia coli O91:H21 tRNA-Sec
  691. Escherichia coli O91:H28 tRNA-Sec
  692. Escherichia coli O91:NM str. 2009C-3745 tRNA-Sec
  693. Escherichia coli O91 str. RM7190 tRNA-Sec
  694. Escherichia coli O91 tRNA-Sec
  695. Escherichia coli O96 tRNA-Sec
  696. Escherichia coli O99:H27 tRNA-Sec
  697. Escherichia coli O9:H10 tRNA-Sec
  698. Escherichia coli OP50 tRNA-Sec
  699. Escherichia coli OX01:H8 tRNA-Sec
  700. Escherichia coli OX38:H47 tRNA-Sec
  701. Escherichia coli P12b tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  702. Escherichia coli P4-96 tRNA-Sec
  703. Escherichia coli P4-NR tRNA-Sec
  704. Escherichia coli PMV-1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  705. Escherichia coli RS218 tRNA-Sec
  706. Escherichia coli S17 tRNA-Sec
  707. Escherichia coli S88 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  708. Escherichia coli SCI-07 tRNA-Sec
  709. Escherichia coli SE11 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  710. Escherichia coli SE15 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  711. Escherichia coli SEPT362 tRNA-Sec
  712. Escherichia coli SHECO002 tRNA-Sec
  713. Escherichia coli SHECO003 tRNA-Sec
  714. Escherichia coli SMS-3-5 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  715. Escherichia coli str. 'clone D i14' tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  716. Escherichia coli str. 'clone D i2' tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  717. Escherichia coli str. K-12 substr. DH10B tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  718. Escherichia coli str. K-12 substr. MC4100 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  719. Escherichia coli str. K-12 substr. MDS42 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  720. Escherichia coli str. K-12 substr. W3110 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  721. Escherichia coli str. Sanji tRNA-Sec
  722. Escherichia coli tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  723. Escherichia coli UCI 52 tRNA-Sec
  724. Escherichia coli UM146 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  725. Escherichia coli UMEA 3252-1 tRNA-Sec
  726. Escherichia coli UMN026 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  727. Escherichia coli UMNF18 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  728. Escherichia coli UMNK88 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  729. Escherichia coli UTI89 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  730. Escherichia coli VL2732 tRNA-Sec
  731. Escherichia coli VL2874 tRNA-Sec
  732. Escherichia coli VR50 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  733. Escherichia coli W tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  734. Escherichia coli XH001 tRNA-Sec
  735. Escherichia coli XH140A tRNA-Sec
  736. Escherichia coli Xuzhou21 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  737. Escherichia fergusonii ATCC 35469 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  738. Escherichia fergusonii tRNA-seC(tca)
  739. Escherichia marmotae tRNA-Sec
  740. Escherichia ruysiae tRNA-Sec
  741. Escherichia sp. 0.2392 tRNA-Sec
  742. Escherichia sp. 11.1596 tRNA-Sec
  743. Escherichia sp. 11.1597 tRNA-Sec
  744. Escherichia sp. 11.1600 tRNA-Sec
  745. Escherichia sp. 12.2610 tRNA-Sec
  746. Escherichia sp. 12.2612 tRNA-Sec
  747. Escherichia sp. 14.0982 tRNA-Sec
  748. Escherichia sp. 14.0985 tRNA-Sec
  749. Escherichia sp. 14.0993 tRNA-Sec
  750. Escherichia sp. 20412-1 tRNA-Sec
  751. Escherichia sp. 4726-5 tRNA-Sec
  752. Escherichia sp. 79.0191 tRNA-Sec
  753. Escherichia sp. 8.2195 tRNA-Sec
  754. Escherichia sp. 92.1228 tRNA-Sec
  755. Escherichia sp. 93.0724 tRNA-Sec
  756. Escherichia sp. 93.0743 tRNA-Sec
  757. Escherichia sp. 93.0750 tRNA-Sec
  758. Escherichia sp. 93.0816 tRNA-Sec
  759. Escherichia sp. 93.1447 tRNA-Sec
  760. Escherichia sp. 93.1462 tRNA-Sec
  761. Escherichia sp. 93.1518 tRNA-Sec
  762. Escherichia sp. 94.0001 tRNA-Sec
  763. Escherichia sp. E10V10 tRNA-Sec
  764. Escherichia sp. E10V4 tRNA-Sec
  765. Escherichia sp. E10V5 tRNA-Sec
  766. Escherichia sp. E1130 tRNA-Sec
  767. Escherichia sp. E13S3 tRNA-Sec
  768. Escherichia sp. E14S1 tRNA-Sec
  769. Escherichia sp. E14V10 tRNA-Sec
  770. Escherichia sp. E14V5 tRNA-Sec
  771. Escherichia sp. E14V7 tRNA-Sec
  772. Escherichia sp. E1S7 tRNA-Sec
  773. Escherichia sp. E1V33 tRNA-Sec
  774. Escherichia sp. E2562 tRNA-Sec
  775. Escherichia sp. E2586 tRNA-Sec
  776. Escherichia sp. E2593 tRNA-Sec
  777. Escherichia sp. E2661 tRNA-Sec
  778. Escherichia sp. E2748 tRNA-Sec
  779. Escherichia sp. E3356 tRNA-Sec
  780. Escherichia sp. E3659 tRNA-Sec
  781. Escherichia sp. E4208 tRNA-Sec
  782. Escherichia sp. E4385 tRNA-Sec
  783. Escherichia sp. E4694 tRNA-Sec
  784. Escherichia sp. E4702 tRNA-Sec
  785. Escherichia sp. E4736 tRNA-Sec
  786. Escherichia sp. E4742 tRNA-Sec
  787. Escherichia sp. E4930 tRNA-Sec
  788. Escherichia sp. E5028 tRNA-Sec
  789. Escherichia sp. Gen1 tRNA-Sec
  790. Escherichia sp. HH26CH tRNA-Sec
  791. Escherichia sp. HH41S tRNA-Sec
  792. Escherichia sp. JL983 tRNA-Sec
  793. Escherichia sp. KCJ4928 tRNA-Sec
  794. Escherichia sp. KCJ4943 tRNA-Sec
  795. Escherichia hominis tRNA-Sec
  796. Escherichia sp. MOD1-EC5451 tRNA-Sec
  797. Escherichia sp. MOD1-EC6475 tRNA-Sec
  798. Escherichia sp. MR tRNA-Sec
  799. Escherichia sp. NIC32-2 tRNA-Sec
  800. Escherichia sp. NT45 tRNA-Sec
  801. Escherichia sp. R8 tRNA-Sec
  802. Escherichia sp. S2_ASV_4 tRNA-Sec
  803. Escherichia sp. S69_ASV_4 tRNA-Sec
  804. Escherichia sp. S85_ASV_4 tRNA-Sec
  805. Escherichia whittamii tRNA-Sec
  806. Escherichia sp. SCLE84 tRNA-Sec
  807. Escherichia sp. TC-EC600-tetX4 tRNA-Sec
  808. Escherichia sp. TM-G17TGC tRNA-Sec
  809. Escherichia sp. (wastewater metagenome) tRNA-Sec
  810. Franconibacter daqui tRNA-Sec
  811. Franconibacter helveticus tRNA-Sec
  812. Franconibacter pulveris (terrestrial metagenome) tRNA-Sec
  813. Intestinirhabdus alba tRNA-Sec
  814. Jejubacter calystegiae tRNA-Sec
  815. Klebsiella oxytoca tRNA-seC(tca)
  816. Klebsiella pneumoniae tRNA-seC(tca)
  817. Klebsiella sp. STW0522-44 tRNA-SeC
  818. Klebsiella sp. WP3-S18-ESBL-05 tRNA-SeC
  819. Klebsiella sp. WP3-W18-ESBL-02 tRNA-SeC
  820. Klebsiella sp. WP4-W18-ESBL-05 tRNA-SeC
  821. Klebsiella sp. WP8-S18-ESBL-06 tRNA-SeC
  822. Kluyvera ascorbata ATCC 33433 tRNA-Sec
  823. Kluyvera ascorbata F0526 tRNA-Sec
  824. Kluyvera ascorbata tRNA-SeC
  825. Kluyvera genomosp. 3 tRNA-Sec
  826. Kluyvera georgiana ATCC 51603 tRNA-Sec
  827. Kluyvera georgiana tRNA-Sec
  828. Kluyvera sichuanensis tRNA-Sec
  829. Kluyvera sp. CRP tRNA-Sec
  830. Pantoea coffeiphila tRNA-Sec
  831. Salmonella bongori CFSAN000510 tRNA-Sec
  832. Salmonella bongori N268-08 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  833. Salmonella bongori NCTC 12419 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  834. Salmonella bongori serovar 40:z35:- str. 95-0123 tRNA-Sec
  835. Salmonella bongori serovar 40:z35:- tRNA-Sec
  836. Salmonella bongori serovar 44:r:- tRNA-Sec
  837. Salmonella bongori serovar 48:i:- str. 94-0708 tRNA-Sec
  838. Salmonella bongori serovar 48:i:- tRNA-Sec
  839. Salmonella bongori serovar 48:z35:- tRNA-Sec
  840. Salmonella bongori serovar 48:z41:-- str. RKS3044 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  841. Salmonella bongori serovar 66:z41:- str. SA19983605 tRNA-Sec
  842. Salmonella bongori serovar 66:z65:- tRNA-Sec
  843. Salmonella bongori tRNA-seC(tca)
  844. Salmonella enterica subsp. arizonae serovar [1],13,23:g,z51:- tRNA-Sec
  845. Salmonella enterica subsp. arizonae serovar 13,23:gz51:- tRNA-Sec
  846. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N23850 tRNA-Sec
  847. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N7307 tRNA-Sec
  848. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- tRNA-Sec
  849. Salmonella enterica subsp. arizonae serovar 18:z4,z32:- tRNA-Sec
  850. Salmonella enterica subsp. arizonae serovar 38:z4,z23:- tRNA-Sec
  851. Salmonella enterica subsp. arizonae serovar 40:z4,z24: tRNA-Sec
  852. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- tRNA-Sec
  853. Salmonella enterica subsp. arizonae serovar 44:z4,z23,z32:- tRNA-Sec
  854. Salmonella enterica subsp. arizonae serovar 47:z4,z23:- tRNA-Sec
  855. Salmonella enterica subsp. arizonae serovar 48:z4,z23:- tRNA-Sec
  856. Salmonella enterica subsp. arizonae serovar 50:r:z tRNA-Sec
  857. Salmonella enterica subsp. arizonae serovar 51:g,z51:- tRNA-Sec
  858. Salmonella enterica subsp. arizonae serovar 56:z4,z23:- tRNA-Sec
  859. Salmonella enterica subsp. arizonae serovar 63:g,z51:- str. So 20/20 tRNA-Sec
  860. Salmonella enterica subsp. arizonae serovar 63:g,z51:- tRNA-Sec
  861. Salmonella enterica subsp. arizonae tRNA-Sec
  862. Salmonella enterica subsp. diarizonae serovar 11:k:z53 tRNA-Sec
  863. Salmonella enterica subsp. diarizonae serovar 16:z10:e,n,x,z15 tRNA-Sec
  864. Salmonella enterica subsp. diarizonae serovar 17:z10:e,n,x,z15 tRNA-Sec
  865. Salmonella enterica subsp. diarizonae serovar 35:k:e,n,x,z15 tRNA-Sec
  866. Salmonella enterica subsp. diarizonae serovar 38:[k]:- tRNA-Sec
  867. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35 tRNA-Sec
  868. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35:- tRNA-Sec
  869. Salmonella enterica subsp. diarizonae serovar 38:k:z tRNA-Sec
  870. Salmonella enterica subsp. diarizonae serovar 47:k:z35 tRNA-Sec
  871. Salmonella enterica subsp. diarizonae serovar 47:k:z53:[z84] tRNA-Sec
  872. Salmonella enterica subsp. diarizonae serovar 48:i:z tRNA-Sec
  873. Salmonella enterica subsp. diarizonae serovar 48:z52:z tRNA-Sec
  874. Salmonella enterica subsp. diarizonae serovar 50:k:z str. MZ0080 tRNA-Sec
  875. Salmonella enterica subsp. diarizonae serovar 50:k:z tRNA-Sec
  876. Salmonella enterica subsp. diarizonae serovar 50:k:z:[z50],[z57],[z68], [z86] tRNA-Sec
  877. Salmonella enterica subsp. diarizonae serovar 50:l,v:z35 tRNA-Sec
  878. Salmonella enterica subsp. diarizonae serovar 50:r:z tRNA-Sec
  879. Salmonella enterica subsp. diarizonae serovar 50:z:- tRNA-Sec
  880. Salmonella enterica subsp. diarizonae serovar 50:z:z52 tRNA-Sec
  881. Salmonella enterica subsp. diarizonae serovar 53:r:z35 tRNA-Sec
  882. Salmonella enterica subsp. diarizonae serovar 53:z10:- tRNA-Sec
  883. Salmonella enterica subsp. diarizonae serovar 59:[k]:z35 tRNA-Sec
  884. Salmonella enterica subsp. diarizonae serovar 59:z10:- tRNA-Sec
  885. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 str. 01-0170 tRNA-Sec
  886. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 tRNA-Sec
  887. Salmonella enterica subsp. diarizonae serovar 61:-:1,5,7 tRNA-Sec
  888. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,(7) (7) tRNA-Sec
  889. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,7 tRNA-Sec
  890. Salmonella enterica subsp. diarizonae serovar 61:l,v:1,5,7 tRNA-Sec
  891. Salmonella enterica subsp. diarizonae serovar 61:l,[v],[z13]:1,5,[7] tRNA-Sec
  892. Salmonella enterica subsp. diarizonae serovar 61:l,v:z35 tRNA-Sec
  893. Salmonella enterica subsp. diarizonae serovar 61:r:z53 tRNA-Sec
  894. Salmonella enterica subsp. diarizonae serovar 61:r:z tRNA-Sec
  895. Salmonella enterica subsp. diarizonae serovar 61:z52:z53 tRNA-Sec
  896. Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 tRNA-Sec
  897. Salmonella enterica subsp. diarizonae serovar 65:z10:e,n,x,z15 tRNA-Sec
  898. Salmonella enterica subsp. diarizonae serovar b,50:-:- tRNA-Sec
  899. Salmonella enterica subsp. diarizonae serovar Rough:r:z tRNA-Sec
  900. Salmonella enterica subsp. diarizonae serovar Rough:-:- tRNA-Sec
  901. Salmonella enterica subsp. diarizonae str. CFSAN000553 tRNA-Sec
  902. Salmonella enterica subsp. diarizonae str. CFSAN000558 tRNA-Sec
  903. Salmonella enterica subsp. diarizonae tRNA-Sec
  904. Salmonella enterica subsp. enterica serovar 1,3,19:g,m,t:- tRNA-Sec
  905. Salmonella enterica subsp. enterica serovar 13,23:b:- tRNA-Sec
  906. Salmonella enterica subsp. enterica serovar 13,23:i:- tRNA-Sec
  907. Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- tRNA-Sec
  908. Salmonella enterica subsp. enterica serovar 16:b:- tRNA-Sec
  909. Salmonella enterica subsp. enterica serovar 1,9,12:-:- tRNA-Sec
  910. Salmonella enterica subsp. enterica serovar 3,10:e,h:- tRNA-Sec
  911. Salmonella enterica subsp. enterica serovar 4,12:d:- tRNA-Sec
  912. Salmonella enterica subsp. enterica serovar 4,12:i:- tRNA-Sec
  913. Salmonella enterica subsp. enterica serovar 4,12:r:- tRNA-Sec
  914. Salmonella enterica subsp. enterica serovar 4:-:1,2 tRNA-Sec
  915. Salmonella enterica subsp. enterica serovar 43:a:1,7 tRNA-Sec
  916. Salmonella enterica subsp. enterica serovar 44:z10:1,7 tRNA-Sec
  917. Salmonella enterica subsp. enterica serovar 4,5,12,27:- tRNA-Sec
  918. Salmonella enterica subsp. enterica serovar 4,[5],12:b:- tRNA-Sec
  919. Salmonella enterica subsp. enterica serovar 4,5,12:b:- tRNA-Sec
  920. Salmonella enterica subsp. enterica serovar 4,[5],12:d:- tRNA-Sec
  921. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1700 tRNA-Sec
  922. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  923. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1739 tRNA-Sec
  924. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701 tRNA-Sec
  925. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- tRNA-Sec
  926. Salmonella enterica subsp. enterica serovar 4,5,12:i tRNA-Sec
  927. Salmonella enterica subsp. enterica serovar 4,5,12:i:- tRNA-Sec
  928. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- tRNA-SeC
  929. Salmonella enterica subsp. enterica serovar 4,[5],12:r:- tRNA-Sec
  930. Salmonella enterica subsp. enterica serovar 4,[5],12:- tRNA-Sec
  931. Salmonella enterica subsp. enterica serovar 4:i:- tRNA-Sec
  932. Salmonella enterica subsp. enterica serovar [5],12,[27]:d:- tRNA-Sec
  933. Salmonella enterica subsp. enterica serovar 51:z:1,5 tRNA-Sec
  934. Salmonella enterica subsp. enterica serovar 6,7,[14]:-:1,5 tRNA-Sec
  935. Salmonella enterica subsp. enterica serovar 6,7,14:g,m[p],s:[1,2,7] tRNA-Sec
  936. Salmonella enterica subsp. enterica serovar 6,7,[14]:r:- tRNA-Sec
  937. Salmonella enterica subsp. enterica serovar 6,7:-:1,5 tRNA-Sec
  938. Salmonella enterica subsp. enterica serovar 6,7:-1,5 tRNA-Sec
  939. Salmonella enterica subsp. enterica serovar 6,7:b:- tRNA-Sec
  940. Salmonella enterica subsp. enterica serovar 6,7:c:1,5 tRNA-Sec
  941. Salmonella enterica subsp. enterica serovar 6,7:e,h:- tRNA-Sec
  942. Salmonella enterica subsp. enterica serovar 6,7:l,v:- tRNA-Sec
  943. Salmonella enterica subsp. enterica serovar 6,7:-:l,w tRNA-Sec
  944. Salmonella enterica subsp. enterica serovar 6,7:-:- tRNA-Sec
  945. Salmonella enterica subsp. enterica serovar 6,8:-:1,2 tRNA-Sec
  946. Salmonella enterica subsp. enterica serovar 6,8,20:d- tRNA-Sec
  947. Salmonella enterica subsp. enterica serovar 6,8:d:- tRNA-Sec
  948. Salmonella enterica subsp. enterica serovar 6,8:i:- tRNA-Sec
  949. Salmonella enterica subsp. enterica serovar 7:d:z35 tRNA-Sec
  950. Salmonella enterica subsp. enterica serovar 8,(20):i:- tRNA-Sec
  951. Salmonella enterica subsp. enterica serovar 8,(20):-:z6 tRNA-Sec
  952. Salmonella enterica subsp. enterica serovar 9,12-:1,5 tRNA-Sec
  953. Salmonella enterica subsp. enterica serovar 9,12:-:1,5 tRNA-Sec
  954. Salmonella enterica subsp. enterica serovar 9,12:l,v:- str. 94293 tRNA-Sec
  955. Salmonella enterica subsp. enterica serovar 9,12:l,z28:- tRNA-Sec
  956. Salmonella enterica subsp. enterica serovar 9,12:- tRNA-Sec
  957. Salmonella enterica subsp. enterica serovar 9,12:-:- tRNA-Sec
  958. Salmonella enterica subsp. enterica serovar Abaetetuba str. ATCC 35640 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  959. Salmonella enterica subsp. enterica serovar Abaetetuba tRNA-Sec
  960. Salmonella enterica subsp. enterica serovar Aba tRNA-Sec
  961. Salmonella enterica subsp. enterica serovar Abeokuta tRNA-Sec
  962. Salmonella enterica subsp. enterica serovar Aberdeen tRNA-Sec
  963. Salmonella enterica subsp. enterica serovar Abony str. 0014 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  964. Salmonella enterica subsp. enterica serovar Abony tRNA-Sec
  965. Salmonella enterica subsp. enterica serovar Abortusequi tRNA-Sec
  966. Salmonella enterica subsp. enterica serovar Abortusovis tRNA-Sec
  967. Salmonella enterica subsp. enterica serovar Adabraka tRNA-Sec
  968. Salmonella enterica subsp. enterica serovar Adamstua tRNA-Sec
  969. Salmonella enterica subsp. enterica serovar Adelaide tRNA-Sec
  970. Salmonella enterica subsp. enterica serovar Aderike tRNA-Sec
  971. Salmonella enterica subsp. enterica serovar Adjame tRNA-Sec
  972. Salmonella enterica subsp. enterica serovar Afula tRNA-Sec
  973. Salmonella enterica subsp. enterica serovar Agama tRNA-Sec
  974. Salmonella enterica subsp. enterica serovar Agbeni tRNA-Sec
  975. Salmonella enterica subsp. enterica serovar Agona str. 0292 tRNA-Sec
  976. Salmonella enterica subsp. enterica serovar Agona str. 0322 tRNA-Sec
  977. Salmonella enterica subsp. enterica serovar Agona str. 241981 tRNA-Sec
  978. Salmonella enterica subsp. enterica serovar Agona str. 24249 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  979. Salmonella enterica subsp. enterica serovar Agona str. 246555-3 tRNA-Sec
  980. Salmonella enterica subsp. enterica serovar Agona str. 266757-1 tRNA-Sec
  981. Salmonella enterica subsp. enterica serovar Agona str. 311387-1 tRNA-Sec
  982. Salmonella enterica subsp. enterica serovar Agona str. 339787 tRNA-Sec
  983. Salmonella enterica subsp. enterica serovar Agona str. 392869-1 tRNA-Sec
  984. Salmonella enterica subsp. enterica serovar Agona str. 392869-2 tRNA-Sec
  985. Salmonella enterica subsp. enterica serovar Agona str. 400095 11 tRNA-Sec
  986. Salmonella enterica subsp. enterica serovar Agona str. 400095 13 tRNA-Sec
  987. Salmonella enterica subsp. enterica serovar Agona str. 400095 14 tRNA-Sec
  988. Salmonella enterica subsp. enterica serovar Agona str. 400095 17 tRNA-Sec
  989. Salmonella enterica subsp. enterica serovar Agona str. 400095 18 tRNA-Sec
  990. Salmonella enterica subsp. enterica serovar Agona str. 400095 19 tRNA-Sec
  991. Salmonella enterica subsp. enterica serovar Agona str. 400095 22 tRNA-Sec
  992. Salmonella enterica subsp. enterica serovar Agona str. 400096 16 tRNA-Sec
  993. Salmonella enterica subsp. enterica serovar Agona str. 400100 30-11 tRNA-Sec
  994. Salmonella enterica subsp. enterica serovar Agona str. 400100 5-3 tRNA-Sec
  995. Salmonella enterica subsp. enterica serovar Agona str. 400100 6-5 tRNA-Sec
  996. Salmonella enterica subsp. enterica serovar Agona str. 400100 7-9 tRNA-Sec
  997. Salmonella enterica subsp. enterica serovar Agona str. 409753-6 tRNA-Sec
  998. Salmonella enterica subsp. enterica serovar Agona str. 419639 2-1 tRNA-Sec
  999. Salmonella enterica subsp. enterica serovar Agona str. 432613 tRNA-Sec
  1000. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-4 tRNA-Sec
  1001. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-5 tRNA-Sec
  1002. Salmonella enterica subsp. enterica serovar Agona str. 447967 1-1 tRNA-Sec
  1003. Salmonella enterica subsp. enterica serovar Agona str. 447967 2-1 tRNA-Sec
  1004. Salmonella enterica subsp. enterica serovar Agona str. 460004 1-1 tRNA-Sec
  1005. Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1006. Salmonella enterica subsp. enterica serovar Agona str. 557928 tRNA-Sec
  1007. Salmonella enterica subsp. enterica serovar Agona str. 620239 tRNA-Sec
  1008. Salmonella enterica subsp. enterica serovar Agona str. 632182-2 tRNA-Sec
  1009. Salmonella enterica subsp. enterica serovar Agona str. 648586-1 tRNA-Sec
  1010. Salmonella enterica subsp. enterica serovar Agona str. ATCC 51957 tRNA-Sec
  1011. Salmonella enterica subsp. enterica serovar Agona str. ATCC BAA-707 tRNA-Sec
  1012. Salmonella enterica subsp. enterica serovar Agona str. SA-1 tRNA-Sec
  1013. Salmonella enterica subsp. enterica serovar Agona str. SA-2 tRNA-Sec
  1014. Salmonella enterica subsp. enterica serovar Agona str. SA-3 tRNA-Sec
  1015. Salmonella enterica subsp. enterica serovar Agona str. SA-4 tRNA-Sec
  1016. Salmonella enterica subsp. enterica serovar Agona str. SA-5 tRNA-Sec
  1017. Salmonella enterica subsp. enterica serovar Agona str. SH08SF124 tRNA-Sec
  1018. Salmonella enterica subsp. enterica serovar Agona str. SH10GFN094 tRNA-Sec
  1019. Salmonella enterica subsp. enterica serovar Agona str. SH11G1113 tRNA-Sec
  1020. Salmonella enterica subsp. enterica serovar Agona str. SL483 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1021. Salmonella enterica subsp. enterica serovar Agona tRNA-Sec
  1022. Salmonella enterica subsp. enterica serovar Ago tRNA-Sec
  1023. Salmonella enterica subsp. enterica serovar Agoueve tRNA-Sec
  1024. Salmonella enterica subsp. enterica serovar Ahuza tRNA-Sec
  1025. Salmonella enterica subsp. enterica serovar Ajiobo tRNA-Sec
  1026. Salmonella enterica subsp. enterica serovar Akanji tRNA-Sec
  1027. Salmonella enterica subsp. enterica serovar Alabama tRNA-Sec
  1028. Salmonella enterica subsp. enterica serovar Alachua tRNA-Sec
  1029. Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 tRNA-Sec
  1030. Salmonella enterica subsp. enterica serovar Albany tRNA-Sec
  1031. Salmonella enterica subsp. enterica serovar Albert tRNA-Sec
  1032. Salmonella enterica subsp. enterica serovar Allandale tRNA-Sec
  1033. Salmonella enterica subsp. enterica serovar Altendorf tRNA-Sec
  1034. Salmonella enterica subsp. enterica serovar Altona tRNA-Sec
  1035. Salmonella enterica subsp. enterica serovar Amager tRNA-Sec
  1036. Salmonella enterica subsp. enterica serovar Amersfoort tRNA-Sec
  1037. Salmonella enterica subsp. enterica serovar Amoutive tRNA-Sec
  1038. Salmonella enterica subsp. enterica serovar Amsterdam tRNA-Sec
  1039. Salmonella enterica subsp. enterica serovar Amsterdam var. 15+,34+ tRNA-Sec
  1040. Salmonella enterica subsp. enterica serovar Anatum str. 0262 tRNA-Sec
  1041. Salmonella enterica subsp. enterica serovar Anatum str. ATCC BAA-1592 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1042. Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1043. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN000511 tRNA-Sec
  1044. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 tRNA-Sec
  1045. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003962 tRNA-Sec
  1046. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003963 tRNA-Sec
  1047. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003964 tRNA-Sec
  1048. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003967 tRNA-Sec
  1049. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003970 tRNA-Sec
  1050. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003971 tRNA-Sec
  1051. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003972 tRNA-Sec
  1052. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003973 tRNA-Sec
  1053. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003974 tRNA-Sec
  1054. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003975 tRNA-Sec
  1055. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004002 tRNA-Sec
  1056. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004004 tRNA-Sec
  1057. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004005 tRNA-Sec
  1058. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004010 tRNA-Sec
  1059. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004011 tRNA-Sec
  1060. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004012 tRNA-Sec
  1061. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004013 tRNA-Sec
  1062. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004014 tRNA-Sec
  1063. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004015 tRNA-Sec
  1064. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004017 tRNA-Sec
  1065. Salmonella enterica subsp. enterica serovar Anatum str. USDA 100 tRNA-Sec
  1066. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1067. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 tRNA-Sec
  1068. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 tRNA-Sec
  1069. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 tRNA-Sec
  1070. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 tRNA-Sec
  1071. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 tRNA-Sec
  1072. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 tRNA-Sec
  1073. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 tRNA-Sec
  1074. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 tRNA-Sec
  1075. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 tRNA-Sec
  1076. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 tRNA-Sec
  1077. Salmonella enterica subsp. enterica serovar Anatum tRNA-Sec
  1078. Salmonella enterica subsp. enterica serovar Anatum var. 15+ tRNA-Sec
  1079. Salmonella enterica subsp. enterica serovar Anderlecht tRNA-Sec
  1080. Salmonella enterica subsp. enterica serovar Anecho tRNA-Sec
  1081. Salmonella enterica subsp. enterica serovar Anfo tRNA-Sec
  1082. Salmonella enterica subsp. enterica serovar Angoda tRNA-Sec
  1083. Salmonella enterica subsp. enterica serovar Ank tRNA-Sec
  1084. Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 tRNA-Sec
  1085. Salmonella enterica subsp. enterica serovar Antsalova tRNA-Sec
  1086. Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 tRNA-Sec
  1087. Salmonella enterica subsp. enterica serovar Apapa tRNA-Sec
  1088. Salmonella enterica subsp. enterica serovar Apeyeme tRNA-Sec
  1089. Salmonella enterica subsp. enterica serovar Aqua str. NVSL2001 tRNA-Sec
  1090. Salmonella enterica subsp. enterica serovar Arechavaleta tRNA-Sec
  1091. Salmonella enterica subsp. enterica serovar Arkansas tRNA-Sec
  1092. Salmonella enterica subsp. enterica serovar Aschersleben tRNA-Sec
  1093. Salmonella enterica subsp. enterica serovar Augustenborg tRNA-Sec
  1094. Salmonella enterica subsp. enterica serovar Austin tRNA-Sec
  1095. Salmonella enterica subsp. enterica serovar Baguida tRNA-Sec
  1096. Salmonella enterica subsp. enterica serovar Bahati tRNA-Sec
  1097. Salmonella enterica subsp. enterica serovar Bahrenfeld tRNA-Sec
  1098. Salmonella enterica subsp. enterica serovar Baildon tRNA-Sec
  1099. Salmonella enterica subsp. enterica serovar Bakau tRNA-Sec
  1100. Salmonella enterica subsp. enterica serovar Ball tRNA-Sec
  1101. Salmonella enterica subsp. enterica serovar Banana tRNA-Sec
  1102. Salmonella enterica subsp. enterica serovar Bardo tRNA-Sec
  1103. Salmonella enterica subsp. enterica serovar Bareilly str. 2780 tRNA-Sec
  1104. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000178 tRNA-Sec
  1105. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000179 tRNA-Sec
  1106. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000180 tRNA-Sec
  1107. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000181 tRNA-Sec
  1108. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000182 tRNA-Sec
  1109. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000184 tRNA-Sec
  1110. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000185 tRNA-Sec
  1111. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000186 tRNA-Sec
  1112. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000187 tRNA-Sec
  1113. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000188 tRNA-Sec
  1114. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1115. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000190 tRNA-Sec
  1116. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000191 tRNA-Sec
  1117. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000192 tRNA-Sec
  1118. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000193 tRNA-Sec
  1119. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000194 tRNA-Sec
  1120. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000195 tRNA-Sec
  1121. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000196 tRNA-Sec
  1122. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000198 tRNA-Sec
  1123. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000199 tRNA-Sec
  1124. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000201 tRNA-Sec
  1125. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000202 tRNA-Sec
  1126. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000203 tRNA-Sec
  1127. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000204 tRNA-Sec
  1128. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000205 tRNA-Sec
  1129. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000206 tRNA-Sec
  1130. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000207 tRNA-Sec
  1131. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000208 tRNA-Sec
  1132. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000209 tRNA-Sec
  1133. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000210 tRNA-Sec
  1134. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000211 tRNA-Sec
  1135. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000212 tRNA-Sec
  1136. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000213 tRNA-Sec
  1137. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000214 tRNA-Sec
  1138. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000215 tRNA-Sec
  1139. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000216 tRNA-Sec
  1140. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000217 tRNA-Sec
  1141. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000218 tRNA-Sec
  1142. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000219 tRNA-Sec
  1143. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000220 tRNA-Sec
  1144. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000221 tRNA-Sec
  1145. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000222 tRNA-Sec
  1146. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000223 tRNA-Sec
  1147. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000224 tRNA-Sec
  1148. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000225 tRNA-Sec
  1149. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000226 tRNA-Sec
  1150. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000227 tRNA-Sec
  1151. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000228 tRNA-Sec
  1152. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000229 tRNA-Sec
  1153. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000230 tRNA-Sec
  1154. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000231 tRNA-Sec
  1155. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000232 tRNA-Sec
  1156. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000233 tRNA-Sec
  1157. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000235 tRNA-Sec
  1158. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000236 tRNA-Sec
  1159. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000661 tRNA-Sec
  1160. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000662 tRNA-Sec
  1161. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 tRNA-Sec
  1162. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000680 tRNA-Sec
  1163. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000700 tRNA-Sec
  1164. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 tRNA-Sec
  1165. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000753 tRNA-Sec
  1166. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000754 tRNA-Sec
  1167. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000755 tRNA-Sec
  1168. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000951 tRNA-Sec
  1169. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000952 tRNA-Sec
  1170. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000953 tRNA-Sec
  1171. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000954 tRNA-Sec
  1172. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000955 tRNA-Sec
  1173. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000956 tRNA-Sec
  1174. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000957 tRNA-Sec
  1175. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000958 tRNA-Sec
  1176. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000959 tRNA-Sec
  1177. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000960 tRNA-Sec
  1178. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000961 tRNA-Sec
  1179. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000962 tRNA-Sec
  1180. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000963 tRNA-Sec
  1181. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000964 tRNA-Sec
  1182. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000965 tRNA-Sec
  1183. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000966 tRNA-Sec
  1184. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000967 tRNA-Sec
  1185. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 tRNA-Sec
  1186. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000969 tRNA-Sec
  1187. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000970 tRNA-Sec
  1188. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001087 tRNA-Sec
  1189. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001088 tRNA-Sec
  1190. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001089 tRNA-Sec
  1191. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001090 tRNA-Sec
  1192. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001099 tRNA-Sec
  1193. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001102 tRNA-Sec
  1194. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001105 tRNA-Sec
  1195. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001107 tRNA-Sec
  1196. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001108 tRNA-Sec
  1197. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001109 tRNA-Sec
  1198. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001111 tRNA-Sec
  1199. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001112 tRNA-Sec
  1200. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001114 tRNA-Sec
  1201. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001115 tRNA-Sec
  1202. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001117 tRNA-Sec
  1203. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001118 tRNA-Sec
  1204. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001140 tRNA-Sec
  1205. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001591 tRNA-Sec
  1206. Salmonella enterica subsp. enterica serovar Bareilly tRNA-Sec
  1207. Salmonella enterica subsp. enterica serovar Bargny tRNA-Sec
  1208. Salmonella enterica subsp. enterica serovar Barranquilla tRNA-Sec
  1209. Salmonella enterica subsp. enterica serovar Beaudesert tRNA-Sec
  1210. Salmonella enterica subsp. enterica serovar Belfast tRNA-Sec
  1211. Salmonella enterica subsp. enterica serovar Benin tRNA-Sec
  1212. Salmonella enterica subsp. enterica serovar Bere tRNA-Sec
  1213. Salmonella enterica subsp. enterica serovar Bergen str. ST350 tRNA-Sec
  1214. Salmonella enterica subsp. enterica serovar Bergen tRNA-Sec
  1215. Salmonella enterica subsp. enterica serovar Berkeley tRNA-Sec
  1216. Salmonella enterica subsp. enterica serovar Berlin tRNA-Sec
  1217. Salmonella enterica subsp. enterica serovar Berta str. ATCC 8392 tRNA-Sec
  1218. Salmonella enterica subsp. enterica serovar Berta str. SA20103550 tRNA-Sec
  1219. Salmonella enterica subsp. enterica serovar Berta tRNA-Sec
  1220. Salmonella enterica subsp. enterica serovar Bietri tRNA-Sec
  1221. Salmonella enterica subsp. enterica serovar Bijlmer tRNA-Sec
  1222. Salmonella enterica subsp. enterica serovar Binza tRNA-Sec
  1223. Salmonella enterica subsp. enterica serovar Birkenhead tRNA-Sec
  1224. Salmonella enterica subsp. enterica serovar Bispebjerg tRNA-Sec
  1225. Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 tRNA-Sec
  1226. Salmonella enterica subsp. enterica serovar Blegdam tRNA-Sec
  1227. Salmonella enterica subsp. enterica serovar Blockley tRNA-Sec
  1228. Salmonella enterica subsp. enterica serovar Blukwa tRNA-Sec
  1229. Salmonella enterica subsp. enterica serovar Bochum tRNA-Sec
  1230. Salmonella enterica subsp. enterica serovar Bonariensis tRNA-Sec
  1231. Salmonella enterica subsp. enterica serovar Bonn tRNA-Sec
  1232. Salmonella enterica subsp. enterica serovar Borreze str. SA20041063 tRNA-Sec
  1233. Salmonella enterica subsp. enterica serovar Bovismorbificans str. 3114 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1234. Salmonella enterica subsp. enterica serovar Bovismorbificans str. Sal610 tRNA-Sec
  1235. Salmonella enterica subsp. enterica serovar Bovismorbificans tRNA-Sec
  1236. Salmonella enterica subsp. enterica serovar Bracknell tRNA-Sec
  1237. Salmonella enterica subsp. enterica serovar Braenderup str. ATCC BAA-664 tRNA-Sec
  1238. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN000756 tRNA-Sec
  1239. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN001745 tRNA-Sec
  1240. Salmonella enterica subsp. enterica serovar Braenderup tRNA-Sec
  1241. Salmonella enterica subsp. enterica serovar Brancaster tRNA-Sec
  1242. Salmonella enterica subsp. enterica serovar Brandenburg tRNA-Sec
  1243. Salmonella enterica subsp. enterica serovar Brazzaville tRNA-Sec
  1244. Salmonella enterica subsp. enterica serovar Breda tRNA-Sec
  1245. Salmonella enterica subsp. enterica serovar Bredeney str. CFSAN001080 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1246. Salmonella enterica subsp. enterica serovar Bredeney tRNA-Sec
  1247. Salmonella enterica subsp. enterica serovar Breukelen tRNA-Sec
  1248. Salmonella enterica subsp. enterica serovar Brevik tRNA-Sec
  1249. Salmonella enterica subsp. enterica serovar Brijbhumi tRNA-Sec
  1250. Salmonella enterica subsp. enterica serovar Bristol tRNA-Sec
  1251. Salmonella enterica subsp. enterica serovar Bron tRNA-Sec
  1252. Salmonella enterica subsp. enterica serovar Bruck tRNA-Sec
  1253. Salmonella enterica subsp. enterica serovar Brunei tRNA-Sec
  1254. Salmonella enterica subsp. enterica serovar Buckeye tRNA-Sec
  1255. Salmonella enterica subsp. enterica serovar Bukavu tRNA-Sec
  1256. Salmonella enterica subsp. enterica serovar Butantan tRNA-Sec
  1257. Salmonella enterica subsp. enterica serovar Buzu tRNA-Sec
  1258. Salmonella enterica subsp. enterica serovar Cairina tRNA-Sec
  1259. Salmonella enterica subsp. enterica serovar Calabar tRNA-Sec
  1260. Salmonella enterica subsp. enterica serovar California tRNA-Sec
  1261. Salmonella enterica subsp. enterica serovar Canada tRNA-Sec
  1262. Salmonella enterica subsp. enterica serovar Cannstatt tRNA-Sec
  1263. Salmonella enterica subsp. enterica serovar Caracas tRNA-Sec
  1264. Salmonella enterica subsp. enterica serovar Cardoner tRNA-Sec
  1265. Salmonella enterica subsp. enterica serovar Carmel tRNA-Sec
  1266. Salmonella enterica subsp. enterica serovar Carno tRNA-Sec
  1267. Salmonella enterica subsp. enterica serovar Carrau tRNA-Sec
  1268. Salmonella enterica subsp. enterica serovar Cerro str. FSL R8-0235 tRNA-Sec
  1269. Salmonella enterica subsp. enterica serovar Cerro str. 5569 tRNA-Sec
  1270. Salmonella enterica subsp. enterica serovar Cerro str. 818 tRNA-Sec
  1271. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001587 tRNA-Sec
  1272. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 tRNA-Sec
  1273. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001589 tRNA-Sec
  1274. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001590 tRNA-Sec
  1275. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001669 tRNA-Sec
  1276. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001670 tRNA-Sec
  1277. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001671 tRNA-Sec
  1278. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001673 tRNA-Sec
  1279. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001674 tRNA-Sec
  1280. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001679 tRNA-Sec
  1281. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001680 tRNA-Sec
  1282. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001681 tRNA-Sec
  1283. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001690 tRNA-Sec
  1284. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001691 tRNA-Sec
  1285. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001692 tRNA-Sec
  1286. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001697 tRNA-Sec
  1287. Salmonella enterica subsp. enterica serovar Cerro tRNA-Sec
  1288. Salmonella enterica subsp. enterica serovar Ceyco tRNA-Sec
  1289. Salmonella enterica subsp. enterica serovar Chailey tRNA-Sec
  1290. Salmonella enterica subsp. enterica serovar Champaign tRNA-Sec
  1291. Salmonella enterica subsp. enterica serovar Chandans tRNA-Sec
  1292. Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 tRNA-Sec
  1293. Salmonella enterica subsp. enterica serovar Chester tRNA-Sec
  1294. Salmonella enterica subsp. enterica serovar Chicago tRNA-Sec
  1295. Salmonella enterica subsp. enterica serovar Chichester tRNA-Sec
  1296. Salmonella enterica subsp. enterica serovar Chincol tRNA-Sec
  1297. Salmonella enterica subsp. enterica serovar Chittagong tRNA-Sec
  1298. Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 tRNA-Sec
  1299. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000514 tRNA-Sec
  1300. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000515 tRNA-Sec
  1301. Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1302. Salmonella enterica subsp. enterica serovar Choleraesuis tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1303. Salmonella enterica subsp. enterica serovar Chomedey tRNA-Sec
  1304. Salmonella enterica subsp. enterica serovar Clackamas tRNA-Sec
  1305. Salmonella enterica subsp. enterica serovar Claibornei tRNA-Sec
  1306. Salmonella enterica subsp. enterica serovar Coeln tRNA-Sec
  1307. Salmonella enterica subsp. enterica serovar Coleypark tRNA-Sec
  1308. Salmonella enterica subsp. enterica serovar Colindale tRNA-Sec
  1309. Salmonella enterica subsp. enterica serovar Colorado tRNA-Sec
  1310. Salmonella enterica subsp. enterica serovar Concord tRNA-Sec
  1311. Salmonella enterica subsp. enterica serovar Copenhagen tRNA-Sec
  1312. Salmonella enterica subsp. enterica serovar Coquilhatville tRNA-Sec
  1313. Salmonella enterica subsp. enterica serovar Corvallis tRNA-Sec
  1314. Salmonella enterica subsp. enterica serovar Cotham tRNA-Sec
  1315. Salmonella enterica subsp. enterica serovar Cremieu tRNA-Sec
  1316. Salmonella enterica subsp. enterica serovar Crossness str. 1422-74 tRNA-Sec
  1317. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1318. Salmonella enterica subsp. enterica serovar Cubana str. CVM42234 tRNA-Sec
  1319. Salmonella enterica subsp. enterica serovar Cubana tRNA-Sec
  1320. Salmonella enterica subsp. enterica serovar Cullingworth tRNA-Sec
  1321. Salmonella enterica subsp. enterica serovar Curacao tRNA-Sec
  1322. Salmonella enterica subsp. enterica serovar Dabou tRNA-Sec
  1323. Salmonella enterica subsp. enterica serovar Daytona tRNA-Sec
  1324. Salmonella enterica subsp. enterica serovar Decatur tRNA-Sec
  1325. Salmonella enterica subsp. enterica serovar Denver tRNA-Sec
  1326. Salmonella enterica subsp. enterica serovar Derby str. 626 tRNA-Sec
  1327. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000564 tRNA-Sec
  1328. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000565 tRNA-Sec
  1329. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000566 tRNA-Sec
  1330. Salmonella enterica subsp. enterica serovar Derby tRNA-Sec
  1331. Salmonella enterica subsp. enterica serovar Dessau tRNA-Sec
  1332. Salmonella enterica subsp. enterica serovar Diguel tRNA-Sec
  1333. Salmonella enterica subsp. enterica serovar Djakarta str. S-1087 tRNA-Sec
  1334. Salmonella enterica subsp. enterica serovar Djugu tRNA-Sec
  1335. Salmonella enterica subsp. enterica serovar Dortmund tRNA-Sec
  1336. Salmonella enterica subsp. enterica serovar Dublin str. 0773 tRNA-Sec
  1337. Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 tRNA-Sec
  1338. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000517 tRNA-Sec
  1339. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000518 tRNA-Sec
  1340. Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1341. Salmonella enterica subsp. enterica serovar Dublin str. SA20093032 tRNA-Sec
  1342. Salmonella enterica subsp. enterica serovar Dublin str. SL1438 tRNA-Sec
  1343. Salmonella enterica subsp. enterica serovar Dublin tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1344. Salmonella enterica subsp. enterica serovar Duesseldorf tRNA-Sec
  1345. Salmonella enterica subsp. enterica serovar Dugbe tRNA-Sec
  1346. Salmonella enterica subsp. enterica serovar Duisburg tRNA-Sec
  1347. Salmonella enterica subsp. enterica serovar Durban tRNA-Sec
  1348. Salmonella enterica subsp. enterica serovar Durham tRNA-Sec
  1349. Salmonella enterica subsp. enterica serovar Ealing tRNA-Sec
  1350. Salmonella enterica subsp. enterica serovar Eastbourne str. CFSAN001084 tRNA-Sec
  1351. Salmonella enterica subsp. enterica serovar Eastbourne tRNA-Sec
  1352. Salmonella enterica subsp. enterica serovar Eboko tRNA-Sec
  1353. Salmonella enterica subsp. enterica serovar Eingedi tRNA-Sec
  1354. Salmonella enterica subsp. enterica serovar Ekotedo tRNA-Sec
  1355. Salmonella enterica subsp. enterica serovar Eko tRNA-Sec
  1356. Salmonella enterica subsp. enterica serovar Ekpoui tRNA-Sec
  1357. Salmonella enterica subsp. enterica serovar Elisabethville tRNA-Sec
  1358. Salmonella enterica subsp. enterica serovar Elomrane tRNA-Sec
  1359. Salmonella enterica subsp. enterica serovar Emek tRNA-Sec
  1360. Salmonella enterica subsp. enterica serovar Enteritidis str. 10-34587 tRNA-Sec
  1361. Salmonella enterica subsp. enterica serovar Enteritidis str. 13183-1 tRNA-Sec
  1362. Salmonella enterica subsp. enterica serovar Enteritidis str. 13-1 tRNA-Sec
  1363. Salmonella enterica subsp. enterica serovar Enteritidis str. 17927 tRNA-Sec
  1364. Salmonella enterica subsp. enterica serovar Enteritidis str. 18569 tRNA-Sec
  1365. Salmonella enterica subsp. enterica serovar Enteritidis str. 20037 tRNA-Sec
  1366. Salmonella enterica subsp. enterica serovar Enteritidis str. 22510-1 tRNA-Sec
  1367. Salmonella enterica subsp. enterica serovar Enteritidis str. 22558 tRNA-Sec
  1368. Salmonella enterica subsp. enterica serovar Enteritidis str. 22704 tRNA-Sec
  1369. Salmonella enterica subsp. enterica serovar Enteritidis str. 33944 tRNA-Sec
  1370. Salmonella enterica subsp. enterica serovar Enteritidis str. 3402 tRNA-Sec
  1371. Salmonella enterica subsp. enterica serovar Enteritidis str. 436 tRNA-Sec
  1372. Salmonella enterica subsp. enterica serovar Enteritidis str. 485549-17 tRNA-Sec
  1373. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-3079 tRNA-Sec
  1374. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-5646 tRNA-Sec
  1375. Salmonella enterica subsp. enterica serovar Enteritidis str. 53-407 tRNA-Sec
  1376. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 22-17 tRNA-Sec
  1377. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 40-18 tRNA-Sec
  1378. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 42-20 tRNA-Sec
  1379. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 1-1 tRNA-Sec
  1380. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 9-7 tRNA-Sec
  1381. Salmonella enterica subsp. enterica serovar Enteritidis str. 576709 tRNA-Sec
  1382. Salmonella enterica subsp. enterica serovar Enteritidis str. 58-6482 tRNA-Sec
  1383. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-22 tRNA-Sec
  1384. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-70 tRNA-Sec
  1385. Salmonella enterica subsp. enterica serovar Enteritidis str. 6.0562-1 tRNA-Sec
  1386. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-2 tRNA-Sec
  1387. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-6 tRNA-Sec
  1388. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-16 tRNA-Sec
  1389. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-19 tRNA-Sec
  1390. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-9 tRNA-Sec
  1391. Salmonella enterica subsp. enterica serovar Enteritidis str. 62-1976 tRNA-Sec
  1392. Salmonella enterica subsp. enterica serovar Enteritidis str. 622731-39 tRNA-Sec
  1393. Salmonella enterica subsp. enterica serovar Enteritidis str. 629163 tRNA-Sec
  1394. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-26 tRNA-Sec
  1395. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-37 tRNA-Sec
  1396. Salmonella enterica subsp. enterica serovar Enteritidis str. 635290-58 tRNA-Sec
  1397. Salmonella enterica subsp. enterica serovar Enteritidis str. 638970-15 tRNA-Sec
  1398. Salmonella enterica subsp. enterica serovar Enteritidis str. 639016-6 tRNA-Sec
  1399. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-46 tRNA-Sec
  1400. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-50 tRNA-Sec
  1401. Salmonella enterica subsp. enterica serovar Enteritidis str. 640631 tRNA-Sec
  1402. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 4-1 tRNA-Sec
  1403. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 8-1 tRNA-Sec
  1404. Salmonella enterica subsp. enterica serovar Enteritidis str. 642046 4-7 tRNA-Sec
  1405. Salmonella enterica subsp. enterica serovar Enteritidis str. 648898 4-5 tRNA-Sec
  1406. Salmonella enterica subsp. enterica serovar Enteritidis str. 648899 3-17 tRNA-Sec
  1407. Salmonella enterica subsp. enterica serovar Enteritidis str. 648900 1-16 tRNA-Sec
  1408. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 1-17 tRNA-Sec
  1409. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 16-16 tRNA-Sec
  1410. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 39-2 tRNA-Sec
  1411. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 6-18 tRNA-Sec
  1412. Salmonella enterica subsp. enterica serovar Enteritidis str. 648902 6-8 tRNA-Sec
  1413. Salmonella enterica subsp. enterica serovar Enteritidis str. 648903 1-6 tRNA-Sec
  1414. Salmonella enterica subsp. enterica serovar Enteritidis str. 648904 3-6 tRNA-Sec
  1415. Salmonella enterica subsp. enterica serovar Enteritidis str. 648905 5-18 tRNA-Sec
  1416. Salmonella enterica subsp. enterica serovar Enteritidis str. 653049 13-19 tRNA-Sec
  1417. Salmonella enterica subsp. enterica serovar Enteritidis str. 674470_11-10 tRNA-Sec
  1418. Salmonella enterica subsp. enterica serovar Enteritidis str. 76-2651 tRNA-Sec
  1419. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-0424 tRNA-Sec
  1420. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1421. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-2659 tRNA-Sec
  1422. Salmonella enterica subsp. enterica serovar Enteritidis str. 78-1757 tRNA-Sec
  1423. Salmonella enterica subsp. enterica serovar Enteritidis str. 81-2625 tRNA-Sec
  1424. Salmonella enterica subsp. enterica serovar Enteritidis str. 8b-1 tRNA-Sec
  1425. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0895 tRNA-Sec
  1426. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0899 tRNA-Sec
  1427. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0956 tRNA-Sec
  1428. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1429. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1010 tRNA-Sec
  1430. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1018 tRNA-Sec
  1431. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1441 tRNA-Sec
  1432. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1444 tRNA-Sec
  1433. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1445 tRNA-Sec
  1434. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1455 tRNA-Sec
  1435. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1457 tRNA-Sec
  1436. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1543 tRNA-Sec
  1437. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1558 tRNA-Sec
  1438. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1559 tRNA-Sec
  1439. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1565 tRNA-Sec
  1440. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1566 tRNA-Sec
  1441. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1575 tRNA-Sec
  1442. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1580 tRNA-Sec
  1443. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1594 tRNA-Sec
  1444. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1725 tRNA-Sec
  1445. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1729 tRNA-Sec
  1446. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1745 tRNA-Sec
  1447. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1747 tRNA-Sec
  1448. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1791 tRNA-Sec
  1449. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1795 tRNA-Sec
  1450. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1808 tRNA-Sec
  1451. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1810 tRNA-Sec
  1452. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1811 tRNA-Sec
  1453. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1882 tRNA-Sec
  1454. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1884 tRNA-Sec
  1455. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000052 tRNA-Sec
  1456. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000568 tRNA-Sec
  1457. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS44 tRNA-Sec
  1458. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS4 tRNA-Sec
  1459. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_56-3991 tRNA-Sec
  1460. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_69-4941 tRNA-Sec
  1461. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_76-3618 tRNA-Sec
  1462. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_81-2490 tRNA-Sec
  1463. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_N202 tRNA-Sec
  1464. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090135 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1465. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090193 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1466. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090195 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1467. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090332 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1468. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090530 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1469. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090531 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1470. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090641 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1471. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090698 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1472. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090884 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1473. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100088 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1474. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100089 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1475. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100100 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1476. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100101 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1477. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100103 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1478. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100130 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1479. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100131 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1480. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100134 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1481. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100325 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1482. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110221 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1483. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110222 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1484. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110223 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1485. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110353 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1486. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110354 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1487. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110355 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1488. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110356 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1489. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110357 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1490. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110358 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1491. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110359 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1492. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110360 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1493. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110361 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1494. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111095 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1495. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111174 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1496. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111175 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1497. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111510 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1498. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111514 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1499. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111515 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1500. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111554 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1501. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111561 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1502. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111576 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1503. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120002 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1504. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120003 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1505. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120005 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1506. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120007 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1507. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120008 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1508. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120009 tRNA-Sec
  1509. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120051 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1510. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120200 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1511. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120213 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1512. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120219 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1513. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120229 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1514. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120240 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1515. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120356 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1516. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120469 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1517. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120496 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1518. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120497 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1519. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120498 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1520. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120505 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1521. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120528 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1522. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120544 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1523. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120548 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1524. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120555 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1525. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120580 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1526. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120581 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1527. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120590 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1528. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120597 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1529. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120677 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1530. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120685 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1531. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120686 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1532. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120687 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1533. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120697 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1534. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120722 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1535. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120734 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1536. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120738 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1537. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120765 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1538. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120773 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1539. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120774 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1540. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120775 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1541. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120776 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1542. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120916 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1543. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120917 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1544. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120918 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1545. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120925 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1546. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120927 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1547. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120929 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1548. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120963 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1549. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120968 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1550. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120969 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1551. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120970 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1552. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120994 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1553. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121004 tRNA-Sec
  1554. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121175 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1555. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121176 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1556. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121177 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1557. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121178 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1558. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121179 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1559. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121180 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1560. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121541 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1561. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121542 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1562. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121671 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1563. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121672 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1564. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121689 tRNA-Sec
  1565. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121744 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1566. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121746 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1567. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121747 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1568. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121748 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1569. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121750 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1570. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121751 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1571. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121753 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1572. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121765 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1573. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121812 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1574. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121825 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1575. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121826 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1576. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121969 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1577. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121970 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1578. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121976 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1579. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121986 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1580. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121989 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1581. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121990 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1582. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122022 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1583. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122026 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1584. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122031 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1585. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122033 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1586. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122045 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1587. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130345 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1588. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130346 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1589. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130347 tRNA-Sec
  1590. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130348 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1591. Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1592. Salmonella enterica subsp. enterica serovar Enteritidis str. PT23 tRNA-Sec
  1593. Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 tRNA-Sec
  1594. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19930684 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1595. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19940857 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1596. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19942384 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1597. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19943269 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1598. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19960848 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1599. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19961622 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1600. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970510 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1601. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970769 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1602. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19971331 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1603. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19980677 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1604. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981522 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1605. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981857 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1606. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19982831 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1607. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19983126 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1608. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19992322 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1609. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19994216 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1610. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20082034 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1611. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083456 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1612. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083636 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1613. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084384 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1614. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084644 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1615. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084824 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1616. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20085285 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1617. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090419 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1618. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090435 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1619. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090877 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1620. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20091739 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1621. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20092320 tRNA-Sec
  1622. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093266 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1623. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093421 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1624. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093430 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1625. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093538 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1626. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093543 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1627. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093784 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1628. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093788 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1629. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093950 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1630. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093977 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1631. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094079 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1632. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094177 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1633. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094301 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1634. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094350 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1635. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094352 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1636. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094383 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1637. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094389 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1638. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094521 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1639. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094642 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1640. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094682 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1641. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094803 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1642. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095309 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1643. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095440 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1644. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100239 tRNA-Sec
  1645. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100349 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1646. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20121703 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1647. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20123395 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1648. Salmonella enterica subsp. enterica serovar Enteritidis str. SARB17 tRNA-Sec
  1649. Salmonella enterica subsp. enterica serovar Enteritidis str. SE10 tRNA-Sec
  1650. Salmonella enterica subsp. enterica serovar Enteritidis str. SE15-1 tRNA-Sec
  1651. Salmonella enterica subsp. enterica serovar Enteritidis str. SE30663 tRNA-Sec
  1652. Salmonella enterica subsp. enterica serovar Enteritidis str. SE8a tRNA-Sec
  1653. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE001 tRNA-Sec
  1654. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE002 tRNA-Sec
  1655. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE003 tRNA-Sec
  1656. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE004 tRNA-Sec
  1657. Salmonella enterica subsp. enterica serovar Enteritidis str. SL909 tRNA-Sec
  1658. Salmonella enterica subsp. enterica serovar Enteritidis str. SL913 tRNA-Sec
  1659. Salmonella enterica subsp. enterica serovar Enteritidis tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1660. Salmonella enterica subsp. enterica serovar Enugu tRNA-Sec
  1661. Salmonella enterica subsp. enterica serovar Eppendorf tRNA-Sec
  1662. Salmonella enterica subsp. enterica serovar Eschberg tRNA-Sec
  1663. Salmonella enterica subsp. enterica serovar Essen tRNA-Sec
  1664. Salmonella enterica subsp. enterica serovar Everleigh tRNA-Sec
  1665. Salmonella enterica subsp. enterica serovar Falkensee tRNA-Sec
  1666. Salmonella enterica subsp. enterica serovar Fallowfield tRNA-Sec
  1667. Salmonella enterica subsp. enterica serovar Fann tRNA-Sec
  1668. Salmonella enterica subsp. enterica serovar Fanti tRNA-Sec
  1669. Salmonella enterica subsp. enterica serovar Farmsen tRNA-Sec
  1670. Salmonella enterica subsp. enterica serovar Florian tRNA-Sec
  1671. Salmonella enterica subsp. enterica serovar Florida tRNA-Sec
  1672. Salmonella enterica subsp. enterica serovar Flottbek tRNA-Sec
  1673. Salmonella enterica subsp. enterica serovar Fluntern tRNA-Sec
  1674. Salmonella enterica subsp. enterica serovar Freetown tRNA-Sec
  1675. Salmonella enterica subsp. enterica serovar Fresno str. ST224 tRNA-Sec
  1676. Salmonella enterica subsp. enterica serovar Fresno tRNA-Sec
  1677. Salmonella enterica subsp. enterica serovar Fufu tRNA-Sec
  1678. Salmonella enterica subsp. enterica serovar Fulica tRNA-Sec
  1679. Salmonella enterica subsp. enterica serovar Gafsa tRNA-Sec
  1680. Salmonella enterica subsp. enterica serovar Galiema tRNA-Sec
  1681. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. CDC1983-67 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1682. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. FCAV198 tRNA-Sec
  1683. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. RKS5078 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1684. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum tRNA-Sec
  1685. Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1686. Salmonella enterica subsp. enterica serovar Gallinarum str. 9184 tRNA-Sec
  1687. Salmonella enterica subsp. enterica serovar Gallinarum str. CFSAN000571 tRNA-Sec
  1688. Salmonella enterica subsp. enterica serovar Gallinarum tRNA-Sec
  1689. Salmonella enterica subsp. enterica serovar Gambia tRNA-Sec
  1690. Salmonella enterica subsp. enterica serovar Gaminara str. ATCC BAA-711 tRNA-Sec
  1691. Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 tRNA-Sec
  1692. Salmonella enterica subsp. enterica serovar Gaminara tRNA-Sec
  1693. Salmonella enterica subsp. enterica serovar Garoli tRNA-Sec
  1694. Salmonella enterica subsp. enterica serovar Gatineau tRNA-Sec
  1695. Salmonella enterica subsp. enterica serovar Gatow tRNA-Sec
  1696. Salmonella enterica subsp. enterica serovar Gatuni tRNA-Sec
  1697. Salmonella enterica subsp. enterica serovar Gdansk tRNA-Sec
  1698. Salmonella enterica subsp. enterica serovar Georgia tRNA-Sec
  1699. Salmonella enterica subsp. enterica serovar Geraldton tRNA-Sec
  1700. Salmonella enterica subsp. enterica serovar Giessen tRNA-Sec
  1701. Salmonella enterica subsp. enterica serovar Give tRNA-Sec
  1702. Salmonella enterica subsp. enterica serovar Give var. 15 str. CFSAN004343 tRNA-Sec
  1703. Salmonella enterica subsp. enterica serovar Glostrup tRNA-Sec
  1704. Salmonella enterica subsp. enterica serovar Gloucester tRNA-Sec
  1705. Salmonella enterica subsp. enterica serovar Godesberg tRNA-Sec
  1706. Salmonella enterica subsp. enterica serovar Gokul tRNA-Sec
  1707. Salmonella enterica subsp. enterica serovar Goldcoast tRNA-Sec
  1708. Salmonella enterica subsp. enterica serovar Gombe tRNA-Sec
  1709. Salmonella enterica subsp. enterica serovar Goverdhan tRNA-Sec
  1710. Salmonella enterica subsp. enterica serovar Grumpensis tRNA-Sec
  1711. Salmonella enterica subsp. enterica serovar Gueuletapee tRNA-Sec
  1712. Salmonella enterica subsp. enterica serovar Guildford tRNA-Sec
  1713. Salmonella enterica subsp. enterica serovar Guinea tRNA-Sec
  1714. Salmonella enterica subsp. enterica serovar Haardt tRNA-Sec
  1715. Salmonella enterica subsp. enterica serovar Hadar str. RI_05P066 tRNA-Sec
  1716. Salmonella enterica subsp. enterica serovar Hadar str. SA20026260 tRNA-Sec
  1717. Salmonella enterica subsp. enterica serovar Hadar tRNA-Sec
  1718. Salmonella enterica subsp. enterica serovar Haduna tRNA-Sec
  1719. Salmonella enterica subsp. enterica serovar Haga tRNA-Sec
  1720. Salmonella enterica subsp. enterica serovar Haifa tRNA-Sec
  1721. Salmonella enterica subsp. enterica serovar Halle tRNA-Sec
  1722. Salmonella enterica subsp. enterica serovar Hartford str. CFSAN001075 tRNA-Sec
  1723. Salmonella enterica subsp. enterica serovar Hartford tRNA-Sec
  1724. Salmonella enterica subsp. enterica serovar Hato tRNA-Sec
  1725. Salmonella enterica subsp. enterica serovar Havana tRNA-Sec
  1726. Salmonella enterica subsp. enterica serovar Hayindogo tRNA-Sec
  1727. Salmonella enterica subsp. enterica serovar Heidelberg str. 21381 tRNA-Sec
  1728. Salmonella enterica subsp. enterica serovar Heidelberg str. 24390 tRNA-Sec
  1729. Salmonella enterica subsp. enterica serovar Heidelberg str. 24393 tRNA-Sec
  1730. Salmonella enterica subsp. enterica serovar Heidelberg str. 29169 tRNA-Sec
  1731. Salmonella enterica subsp. enterica serovar Heidelberg str. 32507 tRNA-Sec
  1732. Salmonella enterica subsp. enterica serovar Heidelberg str. 41563 tRNA-Sec
  1733. Salmonella enterica subsp. enterica serovar Heidelberg str. 41565 tRNA-Sec
  1734. Salmonella enterica subsp. enterica serovar Heidelberg str. 41566 tRNA-Sec
  1735. Salmonella enterica subsp. enterica serovar Heidelberg str. 41567 tRNA-Sec
  1736. Salmonella enterica subsp. enterica serovar Heidelberg str. 41573 tRNA-Sec
  1737. Salmonella enterica subsp. enterica serovar Heidelberg str. 41576 tRNA-Sec
  1738. Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1739. Salmonella enterica subsp. enterica serovar Heidelberg str. 41579 tRNA-Sec
  1740. Salmonella enterica subsp. enterica serovar Heidelberg str. 41584 tRNA-Sec
  1741. Salmonella enterica subsp. enterica serovar Heidelberg str. 579082-8 tRNA-Sec
  1742. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-10 tRNA-Sec
  1743. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-19 tRNA-Sec
  1744. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-34 tRNA-Sec
  1745. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-5 tRNA-Sec
  1746. Salmonella enterica subsp. enterica serovar Heidelberg str. 607310-1 tRNA-Sec
  1747. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-11 tRNA-Sec
  1748. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-12 tRNA-Sec
  1749. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-14 tRNA-Sec
  1750. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-21 tRNA-Sec
  1751. Salmonella enterica subsp. enterica serovar Heidelberg str. 632675-24 tRNA-Sec
  1752. Salmonella enterica subsp. enterica serovar Heidelberg str. 638982-15 tRNA-Sec
  1753. Salmonella enterica subsp. enterica serovar Heidelberg str. 638982-21 tRNA-Sec
  1754. Salmonella enterica subsp. enterica serovar Heidelberg str. 640151-11 tRNA-Sec
  1755. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-3 tRNA-Sec
  1756. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-5 tRNA-Sec
  1757. Salmonella enterica subsp. enterica serovar Heidelberg str. 75-3547 tRNA-Sec
  1758. Salmonella enterica subsp. enterica serovar Heidelberg str. 76-0300 tRNA-Sec
  1759. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-1831 tRNA-Sec
  1760. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-2823 tRNA-Sec
  1761. Salmonella enterica subsp. enterica serovar Heidelberg str. 79-0480 tRNA-Sec
  1762. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-1617 tRNA-Sec
  1763. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-2052 tRNA-Sec
  1764. Salmonella enterica subsp. enterica serovar Heidelberg str. 83-1068 tRNA-Sec
  1765. Salmonella enterica subsp. enterica serovar Heidelberg str. 84-1004 tRNA-Sec
  1766. Salmonella enterica subsp. enterica serovar Heidelberg str. 85-0486 tRNA-Sec
  1767. Salmonella enterica subsp. enterica serovar Heidelberg str. 86-0255 tRNA-Sec
  1768. Salmonella enterica subsp. enterica serovar Heidelberg str. 87-0208 tRNA-Sec
  1769. Salmonella enterica subsp. enterica serovar Heidelberg str. 88-0312 tRNA-Sec
  1770. Salmonella enterica subsp. enterica serovar Heidelberg str. 89-0213 tRNA-Sec
  1771. Salmonella enterica subsp. enterica serovar Heidelberg str. 90-0318 tRNA-Sec
  1772. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0138 tRNA-Sec
  1773. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0144 tRNA-Sec
  1774. Salmonella enterica subsp. enterica serovar Heidelberg str. B182 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1775. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000577 tRNA-Sec
  1776. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000578 tRNA-Sec
  1777. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001902 tRNA-Sec
  1778. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001914 tRNA-Sec
  1779. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002056 tRNA-Sec
  1780. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002057 tRNA-Sec
  1781. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002058 tRNA-Sec
  1782. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002059 tRNA-Sec
  1783. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002060 tRNA-Sec
  1784. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002061 tRNA-Sec
  1785. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002062 tRNA-Sec
  1786. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002063 tRNA-Sec
  1787. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1788. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002065 tRNA-Sec
  1789. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002066 tRNA-Sec
  1790. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002067 tRNA-Sec
  1791. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002068 tRNA-Sec
  1792. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1793. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002071 tRNA-Sec
  1794. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002072 tRNA-Sec
  1795. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002073 tRNA-Sec
  1796. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002074 tRNA-Sec
  1797. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002075 tRNA-Sec
  1798. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00322 tRNA-Sec
  1799. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00323 tRNA-Sec
  1800. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00324 tRNA-Sec
  1801. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00325 tRNA-Sec
  1802. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00326 tRNA-Sec
  1803. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00327 tRNA-Sec
  1804. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00328 tRNA-Sec
  1805. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003462 tRNA-Sec
  1806. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003463 tRNA-Sec
  1807. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003465 tRNA-Sec
  1808. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003467 tRNA-Sec
  1809. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003468 tRNA-Sec
  1810. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003469 tRNA-Sec
  1811. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003472 tRNA-Sec
  1812. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003475 tRNA-Sec
  1813. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003480 tRNA-Sec
  1814. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003482 tRNA-Sec
  1815. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003484 tRNA-Sec
  1816. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003485 tRNA-Sec
  1817. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003487 tRNA-Sec
  1818. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24359 tRNA-Sec
  1819. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24388 tRNA-Sec
  1820. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24391 tRNA-Sec
  1821. Salmonella enterica subsp. enterica serovar Heidelberg str. N1514 tRNA-Sec
  1822. Salmonella enterica subsp. enterica serovar Heidelberg str. N1536 tRNA-Sec
  1823. Salmonella enterica subsp. enterica serovar Heidelberg str. N15757 tRNA-Sec
  1824. Salmonella enterica subsp. enterica serovar Heidelberg str. N18393 tRNA-Sec
  1825. Salmonella enterica subsp. enterica serovar Heidelberg str. N18413 tRNA-Sec
  1826. Salmonella enterica subsp. enterica serovar Heidelberg str. N18440 tRNA-Sec
  1827. Salmonella enterica subsp. enterica serovar Heidelberg str. N18453 tRNA-Sec
  1828. Salmonella enterica subsp. enterica serovar Heidelberg str. N189 tRNA-Sec
  1829. Salmonella enterica subsp. enterica serovar Heidelberg str. N19871 tRNA-Sec
  1830. Salmonella enterica subsp. enterica serovar Heidelberg str. N19992 tRNA-Sec
  1831. Salmonella enterica subsp. enterica serovar Heidelberg str. N20134 tRNA-Sec
  1832. Salmonella enterica subsp. enterica serovar Heidelberg str. N26457 tRNA-Sec
  1833. Salmonella enterica subsp. enterica serovar Heidelberg str. N29341 tRNA-Sec
  1834. Salmonella enterica subsp. enterica serovar Heidelberg str. N30678 tRNA-Sec
  1835. Salmonella enterica subsp. enterica serovar Heidelberg str. N418 tRNA-Sec
  1836. Salmonella enterica subsp. enterica serovar Heidelberg str. N4403 tRNA-Sec
  1837. Salmonella enterica subsp. enterica serovar Heidelberg str. N4496 tRNA-Sec
  1838. Salmonella enterica subsp. enterica serovar Heidelberg str. N4541 tRNA-Sec
  1839. Salmonella enterica subsp. enterica serovar Heidelberg str. N4630 tRNA-Sec
  1840. Salmonella enterica subsp. enterica serovar Heidelberg str. N653 tRNA-Sec
  1841. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013193 tRNA-Sec
  1842. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013312 tRNA-Sec
  1843. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013343 tRNA-Sec
  1844. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013374 tRNA-Sec
  1845. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013988 tRNA-Sec
  1846. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014316 tRNA-Sec
  1847. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014319 tRNA-Sec
  1848. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014588 tRNA-Sec
  1849. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA31 tRNA-Sec
  1850. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA32 tRNA-Sec
  1851. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA33 tRNA-Sec
  1852. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 tRNA-Sec
  1853. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA36 tRNA-Sec
  1854. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA37 tRNA-Sec
  1855. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA 39 tRNA-Sec
  1856. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA40 tRNA-Sec
  1857. Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1858. Salmonella enterica subsp. enterica serovar Heidelberg str. SL486 tRNA-Sec
  1859. Salmonella enterica subsp. enterica serovar Heidelberg tRNA-Sec
  1860. Salmonella enterica subsp. enterica serovar Herston tRNA-Sec
  1861. Salmonella enterica subsp. enterica serovar Hessarek tRNA-Sec
  1862. Salmonella enterica subsp. enterica serovar Hillingdon str. N1529-D3 tRNA-Sec
  1863. Salmonella enterica subsp. enterica serovar Hillingdon tRNA-Sec
  1864. Salmonella enterica subsp. enterica serovar Hindmarsh tRNA-Sec
  1865. Salmonella enterica subsp. enterica serovar Hissar tRNA-Sec
  1866. Salmonella enterica subsp. enterica serovar Holcomb tRNA-Sec
  1867. Salmonella enterica subsp. enterica serovar Horsham tRNA-Sec
  1868. Salmonella enterica subsp. enterica serovar Houston tRNA-Sec
  1869. Salmonella enterica subsp. enterica serovar Hull tRNA-Sec
  1870. Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 tRNA-Sec
  1871. Salmonella enterica subsp. enterica serovar Hvittingfoss tRNA-Sec
  1872. Salmonella enterica subsp. enterica serovar Ibadan tRNA-Sec
  1873. Salmonella enterica subsp. enterica serovar Idikan tRNA-Sec
  1874. Salmonella enterica subsp. enterica serovar Ilala tRNA-Sec
  1875. Salmonella enterica subsp. enterica serovar Indiana str. ATCC 51959 tRNA-Sec
  1876. Salmonella enterica subsp. enterica serovar Indiana tRNA-Sec
  1877. Salmonella enterica subsp. enterica serovar India str. SA20085604 tRNA-Sec
  1878. Salmonella enterica subsp. enterica serovar Infantis str. 335-3 tRNA-Sec
  1879. Salmonella enterica subsp. enterica serovar Infantis str. CFSAN000522 tRNA-Sec
  1880. Salmonella enterica subsp. enterica serovar Infantis str. CVM 17958 tRNA-Sec
  1881. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22577 tRNA-Sec
  1882. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22582 tRNA-Sec
  1883. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23697 tRNA-Sec
  1884. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23729 tRNA-Sec
  1885. Salmonella enterica subsp. enterica serovar Infantis str. CVM 818 tRNA-Sec
  1886. Salmonella enterica subsp. enterica serovar Infantis str. CVM N13139 tRNA-Sec
  1887. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15228 tRNA-Sec
  1888. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15773 tRNA-Sec
  1889. Salmonella enterica subsp. enterica serovar Infantis str. CVM N19983 tRNA-Sec
  1890. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20078 tRNA-Sec
  1891. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20272 tRNA-Sec
  1892. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23532 tRNA-Sec
  1893. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23771 tRNA-Sec
  1894. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23791 tRNA-Sec
  1895. Salmonella enterica subsp. enterica serovar Infantis str. CVM N26093 tRNA-Sec
  1896. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29304 tRNA-Sec
  1897. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29379 tRNA-Sec
  1898. Salmonella enterica subsp. enterica serovar Infantis str. CVM N31594 tRNA-Sec
  1899. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32590PS tRNA-Sec
  1900. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32597PS tRNA-Sec
  1901. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32599PS tRNA-Sec
  1902. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32760 tRNA-Sec
  1903. Salmonella enterica subsp. enterica serovar Infantis str. CVM N34868PS tRNA-Sec
  1904. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35495PS tRNA-Sec
  1905. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35518 tRNA-Sec
  1906. Salmonella enterica subsp. enterica serovar Infantis str. CVM N38848 tRNA-Sec
  1907. Salmonella enterica subsp. enterica serovar Infantis str. CVM N41903 tRNA-Sec
  1908. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42236 tRNA-Sec
  1909. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42459 tRNA-Sec
  1910. Salmonella enterica subsp. enterica serovar Infantis tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1911. Salmonella enterica subsp. enterica serovar Inganda tRNA-Sec
  1912. Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 tRNA-Sec
  1913. Salmonella enterica subsp. enterica serovar Inverness tRNA-Sec
  1914. Salmonella enterica subsp. enterica serovar Irumu tRNA-Sec
  1915. Salmonella enterica subsp. enterica serovar Isangi tRNA-Sec
  1916. Salmonella enterica subsp. enterica serovar Istanbul tRNA-Sec
  1917. Salmonella enterica subsp. enterica serovar Itami str. SA20014991 tRNA-Sec
  1918. Salmonella enterica subsp. enterica serovar Itami tRNA-Sec
  1919. Salmonella enterica subsp. enterica serovar Ituri tRNA-Sec
  1920. Salmonella enterica subsp. enterica serovar Jangwani tRNA-Sec
  1921. Salmonella enterica subsp. enterica serovar Java tRNA-Sec
  1922. Salmonella enterica subsp. enterica serovar Javiana str. 10721 tRNA-Sec
  1923. Salmonella enterica subsp. enterica serovar Javiana str. ATCC BAA-1593 tRNA-Sec
  1924. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000904 tRNA-Sec
  1925. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000905 tRNA-Sec
  1926. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN001992 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  1927. Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433 tRNA-Sec
  1928. Salmonella enterica subsp. enterica serovar Javiana str. PRS_2010_0720 tRNA-Sec
  1929. Salmonella enterica subsp. enterica serovar Javiana tRNA-Sec
  1930. Salmonella enterica subsp. enterica serovar Jedburgh tRNA-Sec
  1931. Salmonella enterica subsp. enterica serovar Jerusalem tRNA-Sec
  1932. Salmonella enterica subsp. enterica serovar Joal tRNA-Sec
  1933. Salmonella enterica subsp. enterica serovar Jodhpur tRNA-Sec
  1934. Salmonella enterica subsp. enterica serovar Johannesburg str. SA20025782 tRNA-Sec
  1935. Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 tRNA-Sec
  1936. Salmonella enterica subsp. enterica serovar Johannesburg tRNA-Sec
  1937. Salmonella enterica subsp. enterica serovar Jubilee tRNA-Sec
  1938. Salmonella enterica subsp. enterica serovar Jukestown tRNA-Sec
  1939. Salmonella enterica subsp. enterica serovar Kaapstad tRNA-Sec
  1940. Salmonella enterica subsp. enterica serovar Kalamu tRNA-Sec
  1941. Salmonella enterica subsp. enterica serovar Kallo tRNA-Sec
  1942. Salmonella enterica subsp. enterica serovar Kambole tRNA-Sec
  1943. Salmonella enterica subsp. enterica serovar Kande tRNA-Sec
  1944. Salmonella enterica subsp. enterica serovar Kaolack tRNA-Sec
  1945. Salmonella enterica subsp. enterica serovar Kapemba tRNA-Sec
  1946. Salmonella enterica subsp. enterica serovar Karamoja tRNA-Sec
  1947. Salmonella enterica subsp. enterica serovar Kasenyi tRNA-Sec
  1948. Salmonella enterica subsp. enterica serovar Kastrup tRNA-Sec
  1949. Salmonella enterica subsp. enterica serovar Kedougou tRNA-Sec
  1950. Salmonella enterica subsp. enterica serovar Kentucky str. 13562 tRNA-Sec
  1951. Salmonella enterica subsp. enterica serovar Kentucky str. 20793 tRNA-Sec
  1952. Salmonella enterica subsp. enterica serovar Kentucky str. 22694 tRNA-Sec
  1953. Salmonella enterica subsp. enterica serovar Kentucky str. 29166 tRNA-Sec
  1954. Salmonella enterica subsp. enterica serovar Kentucky str. CDC 191 tRNA-Sec
  1955. Salmonella enterica subsp. enterica serovar Kentucky str. CVM29188 tRNA-Sec
  1956. Salmonella enterica subsp. enterica serovar Kentucky str. N312 tRNA-Sec
  1957. Salmonella enterica subsp. enterica serovar Kentucky str. SA20030505 tRNA-Sec
  1958. Salmonella enterica subsp. enterica serovar Kentucky tRNA-Sec
  1959. Salmonella enterica subsp. enterica serovar Kenya tRNA-Sec
  1960. Salmonella enterica subsp. enterica serovar Kiambu tRNA-Sec
  1961. Salmonella enterica subsp. enterica serovar Kibi tRNA-Sec
  1962. Salmonella enterica subsp. enterica serovar Kibusi tRNA-Sec
  1963. Salmonella enterica subsp. enterica serovar Kimberley tRNA-Sec
  1964. Salmonella enterica subsp. enterica serovar Kimuenza tRNA-Sec
  1965. Salmonella enterica subsp. enterica serovar Kingabwa tRNA-Sec
  1966. Salmonella enterica subsp. enterica serovar Kingston tRNA-Sec
  1967. Salmonella enterica subsp. enterica serovar Kinondoni tRNA-Sec
  1968. Salmonella enterica subsp. enterica serovar Kinshasa tRNA-Sec
  1969. Salmonella enterica subsp. enterica serovar Kintambo tRNA-Sec
  1970. Salmonella enterica subsp. enterica serovar Kirkee tRNA-Sec
  1971. Salmonella enterica subsp. enterica serovar Kisangani tRNA-Sec
  1972. Salmonella enterica subsp. enterica serovar Kisarawe tRNA-Sec
  1973. Salmonella enterica subsp. enterica serovar Kisii tRNA-Sec
  1974. Salmonella enterica subsp. enterica serovar Koessen str. S-1501 tRNA-Sec
  1975. Salmonella enterica subsp. enterica serovar Koketime tRNA-Sec
  1976. Salmonella enterica subsp. enterica serovar Kokomlemle tRNA-Sec
  1977. Salmonella enterica subsp. enterica serovar Kottbus tRNA-Sec
  1978. Salmonella enterica subsp. enterica serovar Kouka tRNA-Sec
  1979. Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 tRNA-Sec
  1980. Salmonella enterica subsp. enterica serovar Krefeld tRNA-Sec
  1981. Salmonella enterica subsp. enterica serovar Kua tRNA-Sec
  1982. Salmonella enterica subsp. enterica serovar Kuessel tRNA-Sec
  1983. Salmonella enterica subsp. enterica serovar Kumasi tRNA-Sec
  1984. Salmonella enterica subsp. enterica serovar Kunzendorf tRNA-Sec
  1985. Salmonella enterica subsp. enterica serovar Lagos tRNA-Sec
  1986. Salmonella enterica subsp. enterica serovar Lanka tRNA-Sec
  1987. Salmonella enterica subsp. enterica serovar Lansing tRNA-Sec
  1988. Salmonella enterica subsp. enterica serovar Larochelle tRNA-Sec
  1989. Salmonella enterica subsp. enterica serovar Lattenkamp tRNA-Sec
  1990. Salmonella enterica subsp. enterica serovar Lawndale tRNA-Sec
  1991. Salmonella enterica subsp. enterica serovar Leatherhead tRNA-Sec
  1992. Salmonella enterica subsp. enterica serovar Leeuwarden tRNA-Sec
  1993. Salmonella enterica subsp. enterica serovar Legon tRNA-Sec
  1994. Salmonella enterica subsp. enterica serovar Leoben tRNA-Sec
  1995. Salmonella enterica subsp. enterica serovar Lerum tRNA-Sec
  1996. Salmonella enterica subsp. enterica serovar Lexington tRNA-Sec
  1997. Salmonella enterica subsp. enterica serovar Lexington var. 15+ tRNA-Sec
  1998. Salmonella enterica subsp. enterica serovar Lika tRNA-Sec
  1999. Salmonella enterica subsp. enterica serovar Lille tRNA-Sec
  2000. Salmonella enterica subsp. enterica serovar Limete tRNA-Sec
  2001. Salmonella enterica subsp. enterica serovar Lindern tRNA-Sec
  2002. Salmonella enterica subsp. enterica serovar Lingwala tRNA-Sec
  2003. Salmonella enterica subsp. enterica serovar Linton tRNA-Sec
  2004. Salmonella enterica subsp. enterica serovar Litchfield tRNA-Sec
  2005. Salmonella enterica subsp. enterica serovar Liverpool tRNA-Sec
  2006. Salmonella enterica subsp. enterica serovar Livingstone tRNA-Sec
  2007. Salmonella enterica subsp. enterica serovar Llandoff tRNA-Sec
  2008. Salmonella enterica subsp. enterica serovar Loanda tRNA-Sec
  2009. Salmonella enterica subsp. enterica serovar Lomalinda tRNA-Sec
  2010. Salmonella enterica subsp. enterica serovar Lome tRNA-Sec
  2011. Salmonella enterica subsp. enterica serovar London tRNA-Sec
  2012. Salmonella enterica subsp. enterica serovar Louisiana tRNA-Sec
  2013. Salmonella enterica subsp. enterica serovar Lubbock tRNA-Sec
  2014. Salmonella enterica subsp. enterica serovar Luciana tRNA-Sec
  2015. Salmonella enterica subsp. enterica serovar Luke tRNA-Sec
  2016. Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 tRNA-Sec
  2017. Salmonella enterica subsp. enterica serovar Madelia tRNA-Sec
  2018. Salmonella enterica subsp. enterica serovar Malaysia tRNA-Sec
  2019. Salmonella enterica subsp. enterica serovar Malstatt tRNA-Sec
  2020. Salmonella enterica subsp. enterica serovar Manchester str. ST278 tRNA-Sec
  2021. Salmonella enterica subsp. enterica serovar Manchester tRNA-Sec
  2022. Salmonella enterica subsp. enterica serovar Manhattan str. SA20034532 tRNA-Sec
  2023. Salmonella enterica subsp. enterica serovar Manhattan tRNA-Sec
  2024. Salmonella enterica subsp. enterica serovar Mapo tRNA-Sec
  2025. Salmonella enterica subsp. enterica serovar Maracaibo tRNA-Sec
  2026. Salmonella enterica subsp. enterica serovar Matadi tRNA-Sec
  2027. Salmonella enterica subsp. enterica serovar Matopeni tRNA-Sec
  2028. Salmonella enterica subsp. enterica serovar Mbandaka str. ATCC 51958 tRNA-Sec
  2029. Salmonella enterica subsp. enterica serovar Mbandaka tRNA-Sec
  2030. Salmonella enterica subsp. enterica serovar Meleagridis str. 0047 tRNA-Sec
  2031. Salmonella enterica subsp. enterica serovar Meleagridis tRNA-Sec
  2032. Salmonella enterica subsp. enterica serovar Memphis tRNA-Sec
  2033. Salmonella enterica subsp. enterica serovar Mendoza tRNA-Sec
  2034. Salmonella enterica subsp. enterica serovar Menston tRNA-Sec
  2035. Salmonella enterica subsp. enterica serovar Mesbit tRNA-Sec
  2036. Salmonella enterica subsp. enterica serovar Mgulani tRNA-Sec
  2037. Salmonella enterica subsp. enterica serovar Miami str. 1923 tRNA-Sec
  2038. Salmonella enterica subsp. enterica serovar Miami str. CFSAN000579 tRNA-Sec
  2039. Salmonella enterica subsp. enterica serovar Miami tRNA-Sec
  2040. Salmonella enterica subsp. enterica serovar Michigan tRNA-Sec
  2041. Salmonella enterica subsp. enterica serovar Middlesbrough tRNA-Sec
  2042. Salmonella enterica subsp. enterica serovar Midway tRNA-Sec
  2043. Salmonella enterica subsp. enterica serovar Mikawasima tRNA-Sec
  2044. Salmonella enterica subsp. enterica serovar Millesi tRNA-Sec
  2045. Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 tRNA-Sec
  2046. Salmonella enterica subsp. enterica serovar Minneapolis tRNA-Sec
  2047. Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 tRNA-Sec
  2048. Salmonella enterica subsp. enterica serovar Minnesota tRNA-Sec
  2049. Salmonella enterica subsp. enterica serovar Mishmarhaemek tRNA-Sec
  2050. Salmonella enterica subsp. enterica serovar Mississippi tRNA-Sec
  2051. Salmonella enterica subsp. enterica serovar Moero tRNA-Sec
  2052. Salmonella enterica subsp. enterica serovar Mokola tRNA-Sec
  2053. Salmonella enterica subsp. enterica serovar Molade tRNA-Sec
  2054. Salmonella enterica subsp. enterica serovar Monophasic tRNA-Sec
  2055. Salmonella enterica subsp. enterica serovar Monschaui tRNA-Sec
  2056. Salmonella enterica subsp. enterica serovar Montevideo str. 0263 tRNA-Sec
  2057. Salmonella enterica subsp. enterica serovar Montevideo str. 0269 tRNA-Sec
  2058. Salmonella enterica subsp. enterica serovar Montevideo str. 42N tRNA-Sec
  2059. Salmonella enterica subsp. enterica serovar Montevideo str. 468879-1 tRNA-Sec
  2060. Salmonella enterica subsp. enterica serovar Montevideo str. 507440-20 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2061. Salmonella enterica subsp. enterica serovar Montevideo str. 531954 tRNA-Sec
  2062. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-2 tRNA-Sec
  2063. Salmonella enterica subsp. enterica serovar Montevideo str. 644129 tRNA-Sec
  2064. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 07-0954 tRNA-Sec
  2065. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 08-1942 tRNA-Sec
  2066. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 tRNA-Sec
  2067. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 tRNA-Sec
  2068. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2011K-1674 tRNA-Sec
  2069. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2012K-1544 tRNA-Sec
  2070. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2013K-0218 tRNA-Sec
  2071. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 86-0391 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2072. Salmonella enterica subsp. enterica serovar Montevideo str. CFSAN004346 tRNA-Sec
  2073. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-2868 tRNA-Sec
  2074. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4673 tRNA-Sec
  2075. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4843 tRNA-Sec
  2076. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4916 tRNA-Sec
  2077. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4922 tRNA-Sec
  2078. Salmonella enterica subsp. enterica serovar Montevideo str. FVM_628064 tRNA-Sec
  2079. Salmonella enterica subsp. enterica serovar Montevideo str. N19965 tRNA-Sec
  2080. Salmonella enterica subsp. enterica serovar Montevideo str. SARB31 tRNA-Sec
  2081. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1900 tRNA-Sec
  2082. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1901 tRNA-Sec
  2083. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1903 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2084. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1904 tRNA-Sec
  2085. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1912 tRNA-Sec
  2086. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 tRNA-Sec
  2087. Salmonella enterica subsp. enterica serovar Montevideo tRNA-Sec
  2088. Salmonella enterica subsp. enterica serovar Morehead tRNA-Sec
  2089. Salmonella enterica subsp. enterica serovar Moroto tRNA-Sec
  2090. Salmonella enterica subsp. enterica serovar Moscow str. S-1843 tRNA-Sec
  2091. Salmonella enterica subsp. enterica serovar Moscow str. SA20061414 tRNA-Sec
  2092. Salmonella enterica subsp. enterica serovar Moscow tRNA-Sec
  2093. Salmonella enterica subsp. enterica serovar Mountpleasant tRNA-Sec
  2094. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000585 tRNA-Sec
  2095. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000591 tRNA-Sec
  2096. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000593 tRNA-Sec
  2097. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000595 tRNA-Sec
  2098. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000596 tRNA-Sec
  2099. Salmonella enterica subsp. enterica serovar Muenchen str. RKS4129 tRNA-Sec
  2100. Salmonella enterica subsp. enterica serovar Muenchen tRNA-Sec
  2101. Salmonella enterica subsp. enterica serovar Muenster str. 0315 tRNA-Sec
  2102. Salmonella enterica subsp. enterica serovar Muenster str. 420 tRNA-Sec
  2103. Salmonella enterica subsp. enterica serovar Muenster str. 660 tRNA-Sec
  2104. Salmonella enterica subsp. enterica serovar Muenster str. CFSAN004344 tRNA-Sec
  2105. Salmonella enterica subsp. enterica serovar Muenster tRNA-Sec
  2106. Salmonella enterica subsp. enterica serovar Nagoya tRNA-Sec
  2107. Salmonella enterica subsp. enterica serovar Namur str. 05-2929 tRNA-Sec
  2108. Salmonella enterica subsp. enterica serovar Napoli tRNA-Sec
  2109. Salmonella enterica subsp. enterica serovar Nchanga tRNA-Sec
  2110. Salmonella enterica subsp. enterica serovar Ndolo tRNA-Sec
  2111. Salmonella enterica subsp. enterica serovar Nessziona tRNA-Sec
  2112. Salmonella enterica subsp. enterica serovar Neukoelln tRNA-Sec
  2113. Salmonella enterica subsp. enterica serovar Neunkirchen tRNA-Sec
  2114. Salmonella enterica subsp. enterica serovar Newbrunswick tRNA-Sec
  2115. Salmonella enterica subsp. enterica serovar Newington tRNA-Sec
  2116. Salmonella enterica subsp. enterica serovar Newlands tRNA-Sec
  2117. Salmonella enterica subsp. enterica serovar Newmexico tRNA-Sec
  2118. Salmonella enterica subsp. enterica serovar Newport str. 0267 tRNA-Sec
  2119. Salmonella enterica subsp. enterica serovar Newport str. #11-2 tRNA-Sec
  2120. Salmonella enterica subsp. enterica serovar Newport str. #11-3 tRNA-Sec
  2121. Salmonella enterica subsp. enterica serovar Newport str. #11-4 tRNA-Sec
  2122. Salmonella enterica subsp. enterica serovar Newport str. 36796 tRNA-Sec
  2123. Salmonella enterica subsp. enterica serovar Newport str. A-211-RVH tRNA-Sec
  2124. Salmonella enterica subsp. enterica serovar Newport str. A-211-TTX tRNA-Sec
  2125. Salmonella enterica subsp. enterica serovar Newport str. CDC 2009K-1331 tRNA-Sec
  2126. Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2127. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 tRNA-Sec
  2128. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 tRNA-Sec
  2129. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000597 tRNA-Sec
  2130. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000598 tRNA-Sec
  2131. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000826 tRNA-Sec
  2132. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000827 tRNA-Sec
  2133. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000828 tRNA-Sec
  2134. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000829 tRNA-Sec
  2135. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000830 tRNA-Sec
  2136. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000831 tRNA-Sec
  2137. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000832 tRNA-Sec
  2138. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000833 tRNA-Sec
  2139. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000834 tRNA-Sec
  2140. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000835 tRNA-Sec
  2141. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000837 tRNA-Sec
  2142. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000901 tRNA-Sec
  2143. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001633 tRNA-Sec
  2144. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001634 tRNA-Sec
  2145. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001635 tRNA-Sec
  2146. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001636 tRNA-Sec
  2147. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001637 tRNA-Sec
  2148. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001638 tRNA-Sec
  2149. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001639 tRNA-Sec
  2150. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001640 tRNA-Sec
  2151. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001641 tRNA-Sec
  2152. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001642 tRNA-Sec
  2153. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001643 tRNA-Sec
  2154. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001644 tRNA-Sec
  2155. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001645 tRNA-Sec
  2156. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001646 tRNA-Sec
  2157. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001647 tRNA-Sec
  2158. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001648 tRNA-Sec
  2159. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001661 tRNA-Sec
  2160. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001889 tRNA-Sec
  2161. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001890 tRNA-Sec
  2162. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001894 tRNA-Sec
  2163. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001895 tRNA-Sec
  2164. Salmonella enterica subsp. enterica serovar Newport str. CVM17619 tRNA-Sec
  2165. Salmonella enterica subsp. enterica serovar Newport str. CVM18000 tRNA-Sec
  2166. Salmonella enterica subsp. enterica serovar Newport str. CVM18005 tRNA-Sec
  2167. Salmonella enterica subsp. enterica serovar Newport str. CVM20775 tRNA-Sec
  2168. Salmonella enterica subsp. enterica serovar Newport str. CVM20776 tRNA-Sec
  2169. Salmonella enterica subsp. enterica serovar Newport str. CVM21537 tRNA-Sec
  2170. Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2171. Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2172. Salmonella enterica subsp. enterica serovar Newport str. CVM 21554 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2173. Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2174. Salmonella enterica subsp. enterica serovar Newport str. CVM22443 tRNA-Sec
  2175. Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2176. Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2177. Salmonella enterica subsp. enterica serovar Newport str. CVM22697 tRNA-Sec
  2178. Salmonella enterica subsp. enterica serovar Newport str. CVM22699 tRNA-Sec
  2179. Salmonella enterica subsp. enterica serovar Newport str. CVM22707 tRNA-Sec
  2180. Salmonella enterica subsp. enterica serovar Newport str. CVM24403 tRNA-Sec
  2181. Salmonella enterica subsp. enterica serovar Newport str. CVM30171 tRNA-Sec
  2182. Salmonella enterica subsp. enterica serovar Newport str. CVM34519 tRNA-Sec
  2183. Salmonella enterica subsp. enterica serovar Newport str. CVM 37978 tRNA-Sec
  2184. Salmonella enterica subsp. enterica serovar Newport str. CVM75_1280 tRNA-Sec
  2185. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1357 tRNA-Sec
  2186. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1594 tRNA-Sec
  2187. Salmonella enterica subsp. enterica serovar Newport str. CVM80_2288 tRNA-Sec
  2188. Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2189. Salmonella enterica subsp. enterica serovar Newport str. CVM N18486 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2190. Salmonella enterica subsp. enterica serovar Newport str. JS09102 tRNA-Sec
  2191. Salmonella enterica subsp. enterica serovar Newport str. JY-221A-RVX tRNA-Sec
  2192. Salmonella enterica subsp. enterica serovar Newport str. JY-223A-RVX tRNA-Sec
  2193. Salmonella enterica subsp. enterica serovar Newport str. L0167 tRNA-Sec
  2194. Salmonella enterica subsp. enterica serovar Newport str. Levine 15 tRNA-Sec
  2195. Salmonella enterica subsp. enterica serovar Newport str. Levine 1 tRNA-Sec
  2196. Salmonella enterica subsp. enterica serovar Newport str. PL01 tRNA-Sec
  2197. Salmonella enterica subsp. enterica serovar Newport str. S09097 tRNA-Sec
  2198. Salmonella enterica subsp. enterica serovar Newport str. S-38A-RVX tRNA-Sec
  2199. Salmonella enterica subsp. enterica serovar Newport str. S-49A-RVX tRNA-Sec
  2200. Salmonella enterica subsp. enterica serovar Newport str. SHSN007 tRNA-Sec
  2201. Salmonella enterica subsp. enterica serovar Newport str. SHSN009 tRNA-Sec
  2202. Salmonella enterica subsp. enterica serovar Newport str. SHSN010 tRNA-Sec
  2203. Salmonella enterica subsp. enterica serovar Newport str. SHSN013 tRNA-Sec
  2204. Salmonella enterica subsp. enterica serovar Newport str. SL254 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2205. Salmonella enterica subsp. enterica serovar Newport str. SL317 tRNA-Sec
  2206. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 tRNA-Sec
  2207. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 tRNA-Sec
  2208. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 tRNA-Sec
  2209. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 tRNA-Sec
  2210. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1927 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2211. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 tRNA-Sec
  2212. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 tRNA-Sec
  2213. Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2214. Salmonella enterica subsp. enterica serovar Newport str. WA_14882 tRNA-Sec
  2215. Salmonella enterica subsp. enterica serovar Newport tRNA-Sec
  2216. Salmonella enterica subsp. enterica serovar Newyork tRNA-Sec
  2217. Salmonella enterica subsp. enterica serovar Ngili tRNA-Sec
  2218. Salmonella enterica subsp. enterica serovar Nigeria tRNA-Sec
  2219. Salmonella enterica subsp. enterica serovar Nijmegen tRNA-Sec
  2220. Salmonella enterica subsp. enterica serovar Nima tRNA-Sec
  2221. Salmonella enterica subsp. enterica serovar Nitra tRNA-Sec
  2222. Salmonella enterica subsp. enterica serovar Norwich str. CFSAN001077 tRNA-Sec
  2223. Salmonella enterica subsp. enterica serovar Norwich tRNA-Sec
  2224. Salmonella enterica subsp. enterica serovar Nottingham tRNA-Sec
  2225. Salmonella enterica subsp. enterica serovar Noya tRNA-Sec
  2226. Salmonella enterica subsp. enterica serovar Nyanza tRNA-Sec
  2227. Salmonella enterica subsp. enterica serovar Oakland tRNA-Sec
  2228. Salmonella enterica subsp. enterica serovar Obogu tRNA-Sec
  2229. Salmonella enterica subsp. enterica serovar Odozi tRNA-Sec
  2230. Salmonella enterica subsp. enterica serovar Offa tRNA-Sec
  2231. Salmonella enterica subsp. enterica serovar Ohio str. CFSAN001079 tRNA-Sec
  2232. Salmonella enterica subsp. enterica serovar Ohio tRNA-Sec
  2233. Salmonella enterica subsp. enterica serovar Okatie tRNA-Sec
  2234. Salmonella enterica subsp. enterica serovar Olten tRNA-Sec
  2235. Salmonella enterica subsp. enterica serovar Omuna tRNA-Sec
  2236. Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 tRNA-Sec
  2237. Salmonella enterica subsp. enterica serovar Onderstepoort tRNA-Sec
  2238. Salmonella enterica subsp. enterica serovar Onireke tRNA-Sec
  2239. Salmonella enterica subsp. enterica serovar Oranienburg str. 0250 tRNA-Sec
  2240. Salmonella enterica subsp. enterica serovar Oranienburg str. 701 tRNA-Sec
  2241. Salmonella enterica subsp. enterica serovar Oranienburg str. S-76 tRNA-Sec
  2242. Salmonella enterica subsp. enterica serovar Oranienburg tRNA-Sec
  2243. Salmonella enterica subsp. enterica serovar Ordonez tRNA-Sec
  2244. Salmonella enterica subsp. enterica serovar Orientalis tRNA-Sec
  2245. Salmonella enterica subsp. enterica serovar Orion tRNA-Sec
  2246. Salmonella enterica subsp. enterica serovar O rough tRNA-Sec
  2247. Salmonella enterica subsp. enterica serovar Oskarshamn tRNA-Sec
  2248. Salmonella enterica subsp. enterica serovar Oslo tRNA-Sec
  2249. Salmonella enterica subsp. enterica serovar Othmarschen tRNA-Sec
  2250. Salmonella enterica subsp. enterica serovar Ouagadougou tRNA-Sec
  2251. Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 tRNA-Sec
  2252. Salmonella enterica subsp. enterica serovar Ouakam tRNA-Sec
  2253. Salmonella enterica subsp. enterica serovar Oudwijk tRNA-Sec
  2254. Salmonella enterica subsp. enterica serovar Overschie tRNA-Sec
  2255. Salmonella enterica subsp. enterica serovar Pakistan tRNA-Sec
  2256. Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 tRNA-Sec
  2257. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000600 tRNA-Sec
  2258. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000601 tRNA-Sec
  2259. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000602 tRNA-Sec
  2260. Salmonella enterica subsp. enterica serovar Panama str. SA20030878 tRNA-Sec
  2261. Salmonella enterica subsp. enterica serovar Panama tRNA-Sec
  2262. Salmonella enterica subsp. enterica serovar Papuana tRNA-Sec
  2263. Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2264. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 tRNA-Sec
  2265. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2266. Salmonella enterica subsp. enterica serovar Paratyphi A str. SA19950809 tRNA-Sec
  2267. Salmonella enterica subsp. enterica serovar Paratyphi A tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2268. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 10719 tRNA-Sec
  2269. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 19940 tRNA-Sec
  2270. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 51962 tRNA-Sec
  2271. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 8759 tRNA-Sec
  2272. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC BAA-1585 tRNA-Sec
  2273. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000527 tRNA-Sec
  2274. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000532 tRNA-Sec
  2275. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000536 tRNA-Sec
  2276. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000540 tRNA-Sec
  2277. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000541 tRNA-Sec
  2278. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000542 tRNA-Sec
  2279. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000545 tRNA-Sec
  2280. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000547 tRNA-Sec
  2281. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000548 tRNA-Sec
  2282. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000549 tRNA-Sec
  2283. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA42 tRNA-Sec
  2284. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA56 tRNA-Sec
  2285. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA61 tRNA-Sec
  2286. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA62 tRNA-Sec
  2287. Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2288. Salmonella enterica subsp. enterica serovar Paratyphi B tRNA-Sec
  2289. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000603 tRNA-Sec
  2290. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000604 tRNA-Sec
  2291. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000605 tRNA-Sec
  2292. Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2293. Salmonella enterica subsp. enterica serovar Paratyphi C tRNA-Sec
  2294. Salmonella enterica subsp. enterica serovar Parkroyal tRNA-Sec
  2295. Salmonella enterica subsp. enterica serovar Pasing tRNA-Sec
  2296. Salmonella enterica subsp. enterica serovar Penarth tRNA-Sec
  2297. Salmonella enterica subsp. enterica serovar Pensacola tRNA-Sec
  2298. Salmonella enterica subsp. enterica serovar Plymouth tRNA-Sec
  2299. Salmonella enterica subsp. enterica serovar Poano tRNA-Sec
  2300. Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 tRNA-Sec
  2301. Salmonella enterica subsp. enterica serovar Pomona tRNA-Sec
  2302. Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 tRNA-Sec
  2303. Salmonella enterica subsp. enterica serovar Poona tRNA-Sec
  2304. Salmonella enterica subsp. enterica serovar Potsdam tRNA-Sec
  2305. Salmonella enterica subsp. enterica serovar Praha tRNA-Sec
  2306. Salmonella enterica subsp. enterica serovar Pretoria tRNA-Sec
  2307. Salmonella enterica subsp. enterica serovar Pullorum str. 13036 tRNA-Sec
  2308. Salmonella enterica subsp. enterica serovar Pullorum str. 19945 tRNA-Sec
  2309. Salmonella enterica subsp. enterica serovar Pullorum str. ATCC 9120 tRNA-Sec
  2310. Salmonella enterica subsp. enterica serovar Pullorum str. CFSAN000606 tRNA-Sec
  2311. Salmonella enterica subsp. enterica serovar Pullorum str. S06004 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2312. Salmonella enterica subsp. enterica serovar Pullorum tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2313. Salmonella enterica subsp. enterica serovar Putten tRNA-Sec
  2314. Salmonella enterica subsp. enterica serovar Quebec str. S-1267 tRNA-Sec
  2315. Salmonella enterica subsp. enterica serovar -:r:1,5 tRNA-Sec
  2316. Salmonella enterica subsp. enterica serovar Ramatgan tRNA-Sec
  2317. Salmonella enterica subsp. enterica serovar Rauform tRNA-Sec
  2318. Salmonella enterica subsp. enterica serovar Reading tRNA-Sec
  2319. Salmonella enterica subsp. enterica serovar Redba tRNA-Sec
  2320. Salmonella enterica subsp. enterica serovar Redlands tRNA-Sec
  2321. Salmonella enterica subsp. enterica serovar Remiremont tRNA-Sec
  2322. Salmonella enterica subsp. enterica serovar Remo tRNA-Sec
  2323. Salmonella enterica subsp. enterica serovar Richmond tRNA-Sec
  2324. Salmonella enterica subsp. enterica serovar Rideau tRNA-Sec
  2325. Salmonella enterica subsp. enterica serovar Ridge tRNA-Sec
  2326. Salmonella enterica subsp. enterica serovar Rissen str. 150 tRNA-Sec
  2327. Salmonella enterica subsp. enterica serovar Rissen tRNA-Sec
  2328. Salmonella enterica subsp. enterica serovar Roodepoort tRNA-Sec
  2329. Salmonella enterica subsp. enterica serovar Rostock tRNA-Sec
  2330. Salmonella enterica subsp. enterica serovar Rottnest tRNA-Sec
  2331. Salmonella enterica subsp. enterica serovar Rough:b:1,2 tRNA-Sec
  2332. Salmonella enterica subsp. enterica serovar Rough O:d:1,7 tRNA-Sec
  2333. Salmonella enterica subsp. enterica serovar Rough O:k:1,5 tRNA-Sec
  2334. Salmonella enterica subsp. enterica serovar Rough O:-:- tRNA-Sec
  2335. Salmonella enterica subsp. enterica serovar Rough O:z29 tRNA-Sec
  2336. Salmonella enterica subsp. enterica serovar Rough O:z4,z23: tRNA-Sec
  2337. Salmonella enterica subsp. enterica serovar Rough:- tRNA-Sec
  2338. Salmonella enterica subsp. enterica serovar Rough:z10:e,n,z15 tRNA-Sec
  2339. Salmonella enterica subsp. enterica serovar Rovaniemi tRNA-Sec
  2340. Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 tRNA-Sec
  2341. Salmonella enterica subsp. enterica serovar Rubislaw str. SA20030553 tRNA-Sec
  2342. Salmonella enterica subsp. enterica serovar Rubislaw tRNA-Sec
  2343. Salmonella enterica subsp. enterica serovar Ruiru tRNA-Sec
  2344. Salmonella enterica subsp. enterica serovar Saarbruecken tRNA-Sec
  2345. Salmonella enterica subsp. enterica serovar Saintpaul str. 9712 tRNA-Sec
  2346. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000612 tRNA-Sec
  2347. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000618 tRNA-Sec
  2348. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000619 tRNA-Sec
  2349. Salmonella enterica subsp. enterica serovar Saintpaul str. JO2008 tRNA-Sec
  2350. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA23 tRNA-Sec
  2351. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA26 tRNA-Sec
  2352. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA29 tRNA-Sec
  2353. Salmonella enterica subsp. enterica serovar Saintpaul tRNA-Sec
  2354. Salmonella enterica subsp. enterica serovar Salford tRNA-Sec
  2355. Salmonella enterica subsp. enterica serovar Sandiego tRNA-Sec
  2356. Salmonella enterica subsp. enterica serovar Sangera tRNA-Sec
  2357. Salmonella enterica subsp. enterica serovar Sanjuan tRNA-seC(tca)
  2358. Salmonella enterica subsp. enterica serovar Saphra tRNA-Sec
  2359. Salmonella enterica subsp. enterica serovar Sarajane tRNA-Sec
  2360. Salmonella enterica subsp. enterica serovar Schleissheim tRNA-Sec
  2361. Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2362. Salmonella enterica subsp. enterica serovar Schwarzengrund str. SL480 tRNA-Sec
  2363. Salmonella enterica subsp. enterica serovar Schwarzengrund tRNA-Sec
  2364. Salmonella enterica subsp. enterica serovar Seattle tRNA-Sec
  2365. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-Sec
  2366. Salmonella enterica subsp. enterica serovar Sekondi tRNA-Sec
  2367. Salmonella enterica subsp. enterica serovar Sendai str. CFSAN000621 tRNA-Sec
  2368. Salmonella enterica subsp. enterica serovar Sendai tRNA-Sec
  2369. Salmonella enterica subsp. enterica serovar Senegal tRNA-Sec
  2370. Salmonella enterica subsp. enterica serovar Senftenberg str. 316235162 tRNA-Sec
  2371. Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 tRNA-Sec
  2372. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-1 tRNA-Sec
  2373. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-2 tRNA-Sec
  2374. Salmonella enterica subsp. enterica serovar Senftenberg str. 604314 tRNA-Sec
  2375. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 tRNA-Sec
  2376. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 8400 tRNA-Sec
  2377. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 tRNA-Sec
  2378. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004030 tRNA-Sec
  2379. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004031 tRNA-Sec
  2380. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004032 tRNA-Sec
  2381. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004033 tRNA-Sec
  2382. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004041 tRNA-Sec
  2383. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004042 tRNA-Sec
  2384. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004043 tRNA-Sec
  2385. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004044 tRNA-Sec
  2386. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004045 tRNA-Sec
  2387. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004047 tRNA-Sec
  2388. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004048 tRNA-Sec
  2389. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004049 tRNA-Sec
  2390. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004052 tRNA-Sec
  2391. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004054 tRNA-Sec
  2392. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004055 tRNA-Sec
  2393. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004059 tRNA-Sec
  2394. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004060 tRNA-Sec
  2395. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004061 tRNA-Sec
  2396. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004062 tRNA-Sec
  2397. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004063 tRNA-Sec
  2398. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004064 tRNA-Sec
  2399. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004065 tRNA-Sec
  2400. Salmonella enterica subsp. enterica serovar Senftenberg str. NC_MB012510-0038 tRNA-Sec
  2401. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-SeC
  2402. Salmonella enterica subsp. enterica serovar Senneville tRNA-Sec
  2403. Salmonella enterica subsp. enterica serovar Shamba tRNA-Sec
  2404. Salmonella enterica subsp. enterica serovar Shubra tRNA-Sec
  2405. Salmonella enterica subsp. enterica serovar Singapore tRNA-Sec
  2406. Salmonella enterica subsp. enterica serovar Sinstorf tRNA-Sec
  2407. Salmonella enterica subsp. enterica serovar SI Rough:r:1,5 tRNA-Sec
  2408. Salmonella enterica subsp. enterica serovar Sloterdijk str. ATCC 15791 tRNA-Sec
  2409. Salmonella enterica subsp. enterica serovar Solt tRNA-Sec
  2410. Salmonella enterica subsp. enterica serovar Somone tRNA-Sec
  2411. Salmonella enterica subsp. enterica serovar Soumbedioune tRNA-Sec
  2412. Salmonella enterica subsp. enterica serovar Southampton tRNA-Sec
  2413. Salmonella enterica subsp. enterica serovar Southbank tRNA-Sec
  2414. Salmonella enterica subsp. enterica serovar Stanley str. ATCC 7308 tRNA-Sec
  2415. Salmonella enterica subsp. enterica serovar Stanley str. CFSAN000623 tRNA-Sec
  2416. Salmonella enterica subsp. enterica serovar Stanley tRNA-Sec
  2417. Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 tRNA-Sec
  2418. Salmonella enterica subsp. enterica serovar Stanleyville tRNA-Sec
  2419. Salmonella enterica subsp. enterica serovar Stockholm tRNA-Sec
  2420. Salmonella enterica subsp. enterica serovar Stourbridge tRNA-Sec
  2421. Salmonella enterica subsp. enterica serovar Strathcona tRNA-Sec
  2422. Salmonella enterica subsp. enterica serovar Stuttgart tRNA-Sec
  2423. Salmonella enterica subsp. enterica serovar Suberu tRNA-Sec
  2424. Salmonella enterica subsp. enterica serovar Suelldorf tRNA-Sec
  2425. Salmonella enterica subsp. enterica serovar Sundsvall tRNA-Sec
  2426. Salmonella enterica subsp. enterica serovar Szentes tRNA-Sec
  2427. Salmonella enterica subsp. enterica serovar Tafo tRNA-Sec
  2428. Salmonella enterica subsp. enterica serovar Takoradi tRNA-Sec
  2429. Salmonella enterica subsp. enterica serovar Taksony tRNA-Sec
  2430. Salmonella enterica subsp. enterica serovar Tallahassee str. 0012 tRNA-Sec
  2431. Salmonella enterica subsp. enterica serovar Tallahassee tRNA-Sec
  2432. Salmonella enterica subsp. enterica serovar Tamale tRNA-Sec
  2433. Salmonella enterica subsp. enterica serovar Tamberma tRNA-Sec
  2434. Salmonella enterica subsp. enterica serovar Tananarive tRNA-Sec
  2435. Salmonella enterica subsp. enterica serovar Tanger tRNA-Sec
  2436. Salmonella enterica subsp. enterica serovar Tchad tRNA-Sec
  2437. Salmonella enterica subsp. enterica serovar Teddington tRNA-Sec
  2438. Salmonella enterica subsp. enterica serovar Tees tRNA-Sec
  2439. Salmonella enterica subsp. enterica serovar Teko tRNA-Sec
  2440. Salmonella enterica subsp. enterica serovar Telaviv tRNA-Sec
  2441. Salmonella enterica subsp. enterica serovar Telelkebir tRNA-Sec
  2442. Salmonella enterica subsp. enterica serovar Telhashomer tRNA-Sec
  2443. Salmonella enterica subsp. enterica serovar Teltow tRNA-Sec
  2444. Salmonella enterica subsp. enterica serovar Tennessee str. 2691 tRNA-Sec
  2445. Salmonella enterica subsp. enterica serovar Tennessee str. 3133 tRNA-Sec
  2446. Salmonella enterica subsp. enterica serovar Tennessee str. 4535 tRNA-Sec
  2447. Salmonella enterica subsp. enterica serovar Tennessee str. PBO2007 tRNA-Sec
  2448. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-19 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2449. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-21 tRNA-Sec
  2450. Salmonella enterica subsp. enterica serovar Tennessee tRNA-Sec
  2451. Salmonella enterica subsp. enterica serovar Teshie tRNA-Sec
  2452. Salmonella enterica subsp. enterica serovar Texas tRNA-Sec
  2453. Salmonella enterica subsp. enterica serovar Thompson tRNA-Sec
  2454. Salmonella enterica subsp. enterica serovar Tilene tRNA-Sec
  2455. Salmonella enterica subsp. enterica serovar Togba tRNA-Sec
  2456. Salmonella enterica subsp. enterica serovar Toucra tRNA-Sec
  2457. Salmonella enterica subsp. enterica serovar Toulon tRNA-Sec
  2458. Salmonella enterica subsp. enterica serovar Treforest tRNA-Sec
  2459. Salmonella enterica subsp. enterica serovar Tucson tRNA-Sec
  2460. Salmonella enterica subsp. enterica serovar Tudu tRNA-Sec
  2461. Salmonella enterica subsp. enterica serovar Typhimurium str. 104772 tRNA-Sec
  2462. Salmonella enterica subsp. enterica serovar Typhimurium str. 108402 tRNA-Sec
  2463. Salmonella enterica subsp. enterica serovar Typhimurium str. 116045 tRNA-Sec
  2464. Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2465. Salmonella enterica subsp. enterica serovar Typhimurium str. 34502 tRNA-Sec
  2466. Salmonella enterica subsp. enterica serovar Typhimurium str. 35423 tRNA-Sec
  2467. Salmonella enterica subsp. enterica serovar Typhimurium str. 36618 tRNA-Sec
  2468. Salmonella enterica subsp. enterica serovar Typhimurium str. 798 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2469. Salmonella enterica subsp. enterica serovar Typhimurium str. 86-0368 tRNA-Sec
  2470. Salmonella enterica subsp. enterica serovar Typhimurium str. 95799 tRNA-Sec
  2471. Salmonella enterica subsp. enterica serovar Typhimurium str. 98346 tRNA-Sec
  2472. Salmonella enterica subsp. enterica serovar Typhimurium str. AZ 057 tRNA-Sec
  2473. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1153 tRNA-Sec
  2474. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1158 tRNA-Sec
  2475. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1277 tRNA-Sec
  2476. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1283 tRNA-Sec
  2477. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1288 tRNA-Sec
  2478. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 tRNA-Sec
  2479. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-2059 tRNA-Sec
  2480. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 tRNA-Sec
  2481. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2482. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 tRNA-Sec
  2483. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 tRNA-Sec
  2484. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000643 tRNA-Sec
  2485. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000648 tRNA-Sec
  2486. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000653 tRNA-Sec
  2487. Salmonella enterica subsp. enterica serovar Typhimurium str. D23580 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2488. Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2489. Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2490. Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2491. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4_delta.ramA::kan tRNA-Sec
  2492. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4 tRNA-Sec
  2493. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2494. Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 tRNA-Sec
  2495. Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2496. Salmonella enterica subsp. enterica serovar Typhimurium str. ST1489 tRNA-Sec
  2497. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4581 tRNA-Sec
  2498. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4/74 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2499. Salmonella enterica subsp. enterica serovar Typhimurium str. STm10 tRNA-Sec
  2500. Salmonella enterica subsp. enterica serovar Typhimurium str. STm11 tRNA-Sec
  2501. Salmonella enterica subsp. enterica serovar Typhimurium str. STm12 tRNA-Sec
  2502. Salmonella enterica subsp. enterica serovar Typhimurium str. STm1 tRNA-Sec
  2503. Salmonella enterica subsp. enterica serovar Typhimurium str. STm2 tRNA-Sec
  2504. Salmonella enterica subsp. enterica serovar Typhimurium str. STm3 tRNA-Sec
  2505. Salmonella enterica subsp. enterica serovar Typhimurium str. STm4 tRNA-Sec
  2506. Salmonella enterica subsp. enterica serovar Typhimurium str. STm5 tRNA-Sec
  2507. Salmonella enterica subsp. enterica serovar Typhimurium str. STm6 tRNA-Sec
  2508. Salmonella enterica subsp. enterica serovar Typhimurium str. STm7 tRNA-Sec
  2509. Salmonella enterica subsp. enterica serovar Typhimurium str. STm8 tRNA-Sec
  2510. Salmonella enterica subsp. enterica serovar Typhimurium str. STm9 tRNA-Sec
  2511. Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2512. Salmonella enterica subsp. enterica serovar Typhimurium str. U288 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2513. Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2514. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 tRNA-Sec
  2515. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 tRNA-Sec
  2516. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 tRNA-Sec
  2517. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 tRNA-Sec
  2518. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 tRNA-Sec
  2519. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2520. Salmonella enterica subsp. enterica serovar Typhimurium tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2521. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN001921 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2522. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN004345 tRNA-Sec
  2523. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- tRNA-Sec
  2524. Salmonella enterica subsp. enterica serovar Typhimurium var. Copenhagen str. 0084 tRNA-Sec
  2525. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,[5],12:i:- tRNA-Sec
  2526. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,5,12:i:- tRNA-Sec
  2527. Salmonella enterica subsp. enterica serovar Typhi (Salmonella typhi) tRNA-Sec
  2528. Salmonella enterica subsp. enterica serovar Typhi str. 404ty tRNA-Sec
  2529. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000626 tRNA-Sec
  2530. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000628 tRNA-Sec
  2531. Salmonella enterica subsp. enterica serovar Typhi str. CT18 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2532. Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2533. Salmonella enterica subsp. enterica serovar Typhi str. STH2370 tRNA-Sec
  2534. Salmonella enterica subsp. enterica serovar Typhi str. Ty21a tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2535. Salmonella enterica subsp. enterica serovar Typhi str. Ty2 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2536. Salmonella enterica subsp. enterica serovar Typhisuis str. CFSAN000654 tRNA-Sec
  2537. Salmonella enterica subsp. enterica serovar Typhisuis tRNA-Sec
  2538. Salmonella enterica subsp. enterica serovar Tyresoe tRNA-Sec
  2539. Salmonella enterica subsp. enterica serovar Uganda tRNA-Sec
  2540. Salmonella enterica subsp. enterica serovar Uganda var. 15+ tRNA-Sec
  2541. Salmonella enterica subsp. enterica serovar Ughelli tRNA-Sec
  2542. Salmonella enterica subsp. enterica serovar Ullevi tRNA-Sec
  2543. Salmonella enterica subsp. enterica serovar Umbilo tRNA-Sec
  2544. Salmonella enterica subsp. enterica serovar Uppsala tRNA-Sec
  2545. Salmonella enterica subsp. enterica serovar Urbana tRNA-Sec
  2546. Salmonella enterica subsp. enterica serovar Utah tRNA-Sec
  2547. Salmonella enterica subsp. enterica serovar Uzaramo tRNA-Sec
  2548. Salmonella enterica subsp. enterica serovar Vaertan tRNA-Sec
  2549. Salmonella enterica subsp. enterica serovar Vancouver tRNA-Sec
  2550. Salmonella enterica subsp. enterica serovar Vejle tRNA-Sec
  2551. Salmonella enterica subsp. enterica serovar Veneziana tRNA-Sec
  2552. Salmonella enterica subsp. enterica serovar Victoria tRNA-Sec
  2553. Salmonella enterica subsp. enterica serovar Vinohrady tRNA-Sec
  2554. Salmonella enterica subsp. enterica serovar Virchow str. ATCC 51955 tRNA-Sec
  2555. Salmonella enterica subsp. enterica serovar Virchow str. SL491 tRNA-Sec
  2556. Salmonella enterica subsp. enterica serovar Virchow tRNA-Sec
  2557. Salmonella enterica subsp. enterica serovar Virginia str. SA19971529 tRNA-Sec
  2558. Salmonella enterica subsp. enterica serovar Virginia tRNA-Sec
  2559. Salmonella enterica subsp. enterica serovar Vitkin tRNA-Sec
  2560. Salmonella enterica subsp. enterica serovar Volkmarsdorf tRNA-Sec
  2561. Salmonella enterica subsp. enterica serovar Vom tRNA-Sec
  2562. Salmonella enterica subsp. enterica serovar Vuadens tRNA-Sec
  2563. Salmonella enterica subsp. enterica serovar Wagenia tRNA-Sec
  2564. Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 tRNA-Sec
  2565. Salmonella enterica subsp. enterica serovar Wandsworth tRNA-Sec
  2566. Salmonella enterica subsp. enterica serovar Wangata tRNA-Sec
  2567. Salmonella enterica subsp. enterica serovar Warnow tRNA-Sec
  2568. Salmonella enterica subsp. enterica serovar Washington tRNA-Sec
  2569. Salmonella enterica subsp. enterica serovar Wa tRNA-Sec
  2570. Salmonella enterica subsp. enterica serovar Waycross tRNA-Sec
  2571. Salmonella enterica subsp. enterica serovar Wedding tRNA-Sec
  2572. Salmonella enterica subsp. enterica serovar Welikade tRNA-Sec
  2573. Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 tRNA-Sec
  2574. Salmonella enterica subsp. enterica serovar Weltevreden str. HI_N05-537 tRNA-Sec
  2575. Salmonella enterica subsp. enterica serovar Weltevreden tRNA-Sec
  2576. Salmonella enterica subsp. enterica serovar Wentworth tRNA-Sec
  2577. Salmonella enterica subsp. enterica serovar Wernigerode tRNA-Sec
  2578. Salmonella enterica subsp. enterica serovar Weslaco str. 247K tRNA-Sec
  2579. Salmonella enterica subsp. enterica serovar Weslaco tRNA-Sec
  2580. Salmonella enterica subsp. enterica serovar Westhampton tRNA-Sec
  2581. Salmonella enterica subsp. enterica serovar Westminster tRNA-Sec
  2582. Salmonella enterica subsp. enterica serovar Weston tRNA-Sec
  2583. Salmonella enterica subsp. enterica serovar Weybridge tRNA-Sec
  2584. Salmonella enterica subsp. enterica serovar Widemarsh tRNA-Sec
  2585. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000656 tRNA-Sec
  2586. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000657 tRNA-Sec
  2587. Salmonella enterica subsp. enterica serovar Wien tRNA-Sec
  2588. Salmonella enterica subsp. enterica serovar Wilhelmsburg tRNA-Sec
  2589. Salmonella enterica subsp. enterica serovar Winterthur tRNA-Sec
  2590. Salmonella enterica subsp. enterica serovar Woodhull tRNA-Sec
  2591. Salmonella enterica subsp. enterica serovar Woodinville tRNA-Sec
  2592. Salmonella enterica subsp. enterica serovar Worthington str. ATCC 9607 tRNA-Sec
  2593. Salmonella enterica subsp. enterica serovar Worthington str. BCH-3194 tRNA-Sec
  2594. Salmonella enterica subsp. enterica serovar Worthington str. BCH-5715 tRNA-Sec
  2595. Salmonella enterica subsp. enterica serovar Worthington str. BCH-7253 tRNA-Sec
  2596. Salmonella enterica subsp. enterica serovar Worthington tRNA-Sec
  2597. Salmonella enterica subsp. enterica serovar Wyldegreen tRNA-Sec
  2598. Salmonella enterica subsp. enterica serovar Yolo tRNA-Sec
  2599. Salmonella enterica subsp. enterica serovar Yoruba tRNA-Sec
  2600. Salmonella enterica subsp. enterica serovar Yovokome str. S-1850 tRNA-Sec
  2601. Salmonella enterica subsp. enterica serovar Yovokome tRNA-Sec
  2602. Salmonella enterica subsp. enterica serovar Zaiman tRNA-Sec
  2603. Salmonella enterica subsp. enterica serovar Zanzibar tRNA-Sec
  2604. Salmonella enterica subsp. enterica serovar Zega tRNA-Sec
  2605. Salmonella enterica subsp. enterica tRNA-SeC
  2606. Salmonella enterica subsp. houtenae serovar 1,40:z4,z32:- tRNA-Sec
  2607. Salmonella enterica subsp. houtenae serovar 16:z4,z32:- tRNA-Sec
  2608. Salmonella enterica subsp. houtenae serovar 18:z36,z38:- tRNA-Sec
  2609. Salmonella enterica subsp. houtenae serovar 21:z4,z23:- tRNA-Sec
  2610. Salmonella enterica subsp. houtenae serovar 40:z4,z24:- tRNA-Sec
  2611. Salmonella enterica subsp. houtenae serovar 40:z4,z32:- tRNA-Sec
  2612. Salmonella enterica subsp. houtenae serovar 41:z4,z23:- tRNA-Sec
  2613. Salmonella enterica subsp. houtenae serovar 43:z4 tRNA-Sec
  2614. Salmonella enterica subsp. houtenae serovar Houten tRNA-Sec
  2615. Salmonella enterica subsp. houtenae serovar 43:z4,z32:- tRNA-Sec
  2616. Salmonella enterica subsp. houtenae serovar 44:z36,[z38]:- tRNA-Sec
  2617. Salmonella enterica subsp. houtenae serovar 44:z36[z38]:- tRNA-Sec
  2618. Salmonella enterica subsp. houtenae serovar 44:z4,z23:- tRNA-Sec
  2619. Salmonella enterica subsp. houtenae serovar 44:z4,z24:- tRNA-Sec
  2620. Salmonella enterica subsp. houtenae serovar 45:g,z51:- tRNA-Sec
  2621. Salmonella enterica subsp. houtenae serovar 48:g,z51:- tRNA-Sec
  2622. Salmonella enterica subsp. houtenae serovar 48:z4,z32:- tRNA-Sec
  2623. Salmonella enterica subsp. houtenae serovar 50:g,z51:- str. 01-0133 tRNA-Sec
  2624. Salmonella enterica subsp. houtenae serovar 50:g,z51:- tRNA-Sec
  2625. Salmonella enterica subsp. houtenae serovar 50:z4,z23:- tRNA-Sec
  2626. Salmonella enterica subsp. houtenae serovar 53:z4,z23:- tRNA-Sec
  2627. Salmonella enterica subsp. houtenae serovar Houten tRNA-Sec
  2628. Salmonella enterica subsp. houtenae serovar O:11:g,z25:- tRNA-Sec
  2629. Salmonella enterica subsp. houtenae str. CFSAN000552 tRNA-Sec
  2630. Salmonella enterica subsp. houtenae str. CFSAN000557 tRNA-Sec
  2631. Salmonella enterica subsp. houtenae tRNA-Sec
  2632. Salmonella enterica subsp. indica serovar 41:b:1,7 tRNA-Sec
  2633. Salmonella enterica subsp. indica serovar 45:a:e,n,x tRNA-Sec
  2634. Salmonella enterica subsp. indica serovar 6,14,25:z10:1,(2),7 str. 1121 tRNA-Sec
  2635. Salmonella enterica subsp. indica serovar Marseille tRNA-Sec
  2636. Salmonella enterica subsp. indica tRNA-Sec
  2637. Salmonella enterica subsp. salamae serovar 13,22:z:- tRNA-Sec
  2638. Salmonella enterica subsp. salamae serovar 16:m,t:- tRNA-Sec
  2639. Salmonella enterica subsp. salamae serovar 18:z10:z6 tRNA-Sec
  2640. Salmonella enterica subsp. salamae serovar 30:1,z28:z6 tRNA-Sec
  2641. Salmonella enterica subsp. salamae serovar 42:b:1,5 tRNA-Sec
  2642. Salmonella enterica subsp. salamae serovar 42:f,g,t:-- tRNA-Sec
  2643. Salmonella enterica subsp. salamae serovar 42:z:1,5 tRNA-Sec
  2644. Salmonella enterica subsp. salamae serovar 47:a:1,5 tRNA-Sec
  2645. Salmonella enterica subsp. salamae serovar 47:b:1,5 tRNA-Sec
  2646. Salmonella enterica subsp. salamae serovar 48:d:z6 tRNA-Sec
  2647. Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K tRNA-Sec
  2648. Salmonella enterica subsp. salamae serovar 56:b:[1,5] tRNA-Sec
  2649. Salmonella enterica subsp. salamae serovar 56:z10:e,n,x str. 1369-73 tRNA-Sec
  2650. Salmonella enterica subsp. salamae serovar 56:z10:e,n,x tRNA-Sec
  2651. Salmonella enterica subsp. salamae serovar 57:z29:z42 tRNA-Sec
  2652. Salmonella enterica subsp. salamae serovar 58:a:- tRNA-Sec
  2653. Salmonella enterica subsp. salamae serovar 58:d:z6 tRNA-Sec
  2654. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 str. 00-0163 tRNA-Sec
  2655. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 tRNA-Sec
  2656. Salmonella enterica subsp. salamae serovar 60:g,m,t:z6 tRNA-Sec
  2657. Salmonella enterica subsp. salamae serovar 6,7:m,t:- tRNA-Sec
  2658. Salmonella enterica subsp. salamae serovar Greenside tRNA-seC(tca)
  2659. Salmonella enterica subsp. salamae serovar Sofia tRNA-Sec
  2660. Salmonella enterica subsp. salamae serovar Springs tRNA-Sec
  2661. Salmonella enterica subsp. salamae str. CFSAN000559 tRNA-Sec
  2662. Salmonella enterica subsp. salamae tRNA-Sec
  2663. Salmonella enterica subsp. VII serovar 1,40:g,z51:-- tRNA-Sec
  2664. Salmonella enterica subsp. VII serovar 40:z4,z24:[z39] tRNA-Sec
  2665. Salmonella enterica subsp. VII str. CFSAN000554 tRNA-Sec
  2666. Salmonella enterica tRNA-SeC
  2667. Salmonella sp. 2018103 tRNA-Sec
  2668. Salmonella sp. 32010201201800099SM tRNA-Sec
  2669. Salmonella sp. 32010601-2015-00010-FB-01-SM-01 tRNA-Sec
  2670. Salmonella sp. 32010601-2015-00137-FB-01-SM-01 tRNA-Sec
  2671. Salmonella sp. 32010601201600067SM tRNA-Sec
  2672. Salmonella sp. 32010601201800030SM tRNA-Sec
  2673. Salmonella sp. 32011103201800031SM tRNA-Sec
  2674. Salmonella sp. 32011103201800106SM tRNA-Sec
  2675. Salmonella sp. 32011401201800036SM tRNA-Sec
  2676. Salmonella sp. 32011401-201800074SM tRNA-Sec
  2677. Salmonella sp. 32011501201800079SM tRNA-Sec
  2678. Salmonella sp. 32011602201600097SM tRNA-Sec
  2679. Salmonella sp. 32011602201600105SM tRNA-Sec
  2680. Salmonella sp. 32011602201800010SM tRNA-Sec
  2681. Salmonella sp. 32011602201800014SM tRNA-Sec
  2682. Salmonella sp. 32011801201800027SM tRNA-Sec
  2683. Salmonella sp. 32020114201800008SM tRNA-Sec
  2684. Salmonella sp. 32020201-2017-00050-FB-01-SM-01 tRNA-Sec
  2685. Salmonella sp. 32020210201800012SM tRNA-Sec
  2686. Salmonella sp. 32020301-2015-00098-FB-01-SM-01 tRNA-Sec
  2687. Salmonella sp. 32020501-2019-00039 tRNA-Sec
  2688. Salmonella sp. 32020501-2019-00040 tRNA-Sec
  2689. Salmonella sp. 32020501-2019-00041 tRNA-Sec
  2690. Salmonella sp. 32020501-2019-00044 tRNA-Sec
  2691. Salmonella sp. 32020501-2019-00052 tRNA-Sec
  2692. Salmonella sp. 32020509201800054SM tRNA-Sec
  2693. Salmonella sp. 32020509201800068SM tRNA-Sec
  2694. Salmonella sp. 32020512-2019-00017 tRNA-Sec
  2695. Salmonella sp. 32020614-2019-00048 tRNA-Sec
  2696. Salmonella sp. 32021105201800037SM tRNA-Sec
  2697. Salmonella sp. 32031101201600128SM tRNA-Sec
  2698. Salmonella sp. 3203110320150106SM tRNA-Sec
  2699. Salmonella sp. 32031103201600220SM tRNA-Sec
  2700. Salmonella sp. 32031103201600241SM tRNA-Sec
  2701. Salmonella sp. 32031103201600284SM tRNA-Sec
  2702. Salmonella sp. 32031103201600383SM tRNA-Sec
  2703. Salmonella sp. 3203110320160044 tRNA-Sec
  2704. Salmonella sp. 3203110320160052 tRNA-Sec
  2705. Salmonella sp. 3203110320160127 tRNA-Sec
  2706. Salmonella sp. 3203110320160165 tRNA-Sec
  2707. Salmonella sp. 3203110320160211 tRNA-Sec
  2708. Salmonella sp. 32031103-2018-00083-FB-01-SM-01 tRNA-Sec
  2709. Salmonella sp. 32031103-2018-0023-FB-01-SM-01 tRNA-Sec
  2710. Salmonella sp. 32040203201700113FB01SM01 tRNA-Sec
  2711. Salmonella sp. 32040203-2019-00004 tRNA-Sec
  2712. Salmonella sp. 32040203-2019-00032 tRNA-Sec
  2713. Salmonella sp. 32040203-2019-00058 tRNA-Sec
  2714. Salmonella sp. 32040203-2019-00061 tRNA-Sec
  2715. Salmonella sp. 32040203-2019-00097 tRNA-Sec
  2716. Salmonella sp. 32040203-2019-00118 tRNA-Sec
  2717. Salmonella sp. 32040203-2019-00127 tRNA-Sec
  2718. Salmonella sp. 32040203-2019-00133 tRNA-Sec
  2719. Salmonella sp. 32040203-2019-00159 tRNA-Sec
  2720. Salmonella sp. 32040209201700048FB01SM01 tRNA-Sec
  2721. Salmonella sp. 32048101-2015-00023-GS-01-SM-01 tRNA-Sec
  2722. Salmonella sp. 32048101-2015-00025-GS-01-SM-01 tRNA-Sec
  2723. Salmonella sp. 32058101201500184GS-01-SM-01 tRNA-Sec
  2724. Salmonella sp. 32070006-2019-00075 tRNA-Sec
  2725. Salmonella sp. 32070301201500052SM tRNA-Sec
  2726. Salmonella sp. 32070601201500089SM tRNA-Sec
  2727. Salmonella sp. 32080201-2017-00039-FB-01-SM-01 tRNA-Sec
  2728. Salmonella sp. 32081101-2017-00024-FB-01-SM-01 tRNA-Sec
  2729. Salmonella sp. 32082101201600294FB01SM01 tRNA-Sec
  2730. Salmonella sp. 32082101-2017-00322-FB-01-SM-01 tRNA-Sec
  2731. Salmonella sp. 32082101-2019-00528 tRNA-Sec
  2732. Salmonella sp. 32090202-2015-00079-FB-01-SM-01 tRNA-Sec
  2733. Salmonella sp. 32100201201700021SM tRNA-Sec
  2734. Salmonella sp. 32100201201700044SM tRNA-Sec
  2735. Salmonella sp. 32100201201700098SM tRNA-Sec
  2736. Salmonella sp. 32100201201700099SM tRNA-Sec
  2737. Salmonella sp. 32100201201700133SM tRNA-Sec
  2738. Salmonella sp. 32100202201700047SM tRNA-Sec
  2739. Salmonella sp. 32100202201700100SM tRNA-Sec
  2740. Salmonella sp. 32101201-2018-00131-FB-01-SM-01 tRNA-Sec
  2741. Salmonella sp. 32118201201500025SM tRNA-Sec
  2742. Salmonella sp. 32120201201500036SM tRNA-Sec
  2743. Salmonella sp. 32120201201600049SM tRNA-Sec
  2744. Salmonella sp. 32120201201600070SM tRNA-Sec
  2745. Salmonella sp. 32120201201700095FB-01-SM-01 tRNA-Sec
  2746. Salmonella sp. 32120201201700135FB-01-SM-01 tRNA-Sec
  2747. Salmonella sp. 32120201201700237FB-01-SM-01 tRNA-Sec
  2748. Salmonella sp. 32120202201500105SM tRNA-Sec
  2749. Salmonella sp. 32120202201500174SM tRNA-Sec
  2750. Salmonella sp. 32120202201600072SM tRNA-Sec
  2751. Salmonella sp. 32120202201600097SM tRNA-Sec
  2752. Salmonella sp. 32120202201600158SM tRNA-Sec
  2753. Salmonella sp. 32120203201500024SM tRNA-Sec
  2754. Salmonella sp. 32120203201700065FB-01-SM-01 tRNA-Sec
  2755. Salmonella sp. 32130201201500050SM tRNA-Sec
  2756. Salmonella sp. 32130201-2017-00038SM tRNA-Sec
  2757. Salmonella sp. 32132402-2017-00107SM tRNA-Sec
  2758. Salmonella sp. 3C tRNA-Sec
  2759. Salmonella sp. 3DZ2-4SM tRNA-Sec
  2760. Salmonella sp. CVCC 1806 tRNA-Sec
  2761. Salmonella sp. D5-9891 tRNA-Sec
  2762. Salmonella sp. gx-f7 tRNA-Sec
  2763. Salmonella sp. gx-f9 tRNA-Sec
  2764. Salmonella sp. HMSC13B08 tRNA-Sec
  2765. Salmonella sp. hn-f5 tRNA-Sec
  2766. Salmonella sp. hn-h2 tRNA-Sec
  2767. Salmonella sp. hn-h4 tRNA-Sec
  2768. Salmonella sp. HNK130 tRNA-Sec
  2769. Salmonella sp. JS051105201500009SM tRNA-Sec
  2770. Salmonella sp. NCTC 7297 tRNA-seC(tca)
  2771. Salmonella sp. S13 tRNA-Sec
  2772. Salmonella sp. SAL-007 tRNA-Sec
  2773. Salmonella sp. SAL-020 tRNA-Sec
  2774. Salmonella sp. SAL-045 tRNA-Sec
  2775. Salmonella sp. SCFS4 tRNA-Sec
  2776. Salmonella sp. sc-h42 tRNA-Sec
  2777. Salmonella sp. sc-h43 tRNA-Sec
  2778. Salmonella sp. SJTUF14076 tRNA-Sec
  2779. Salmonella sp. SJTUF14146 tRNA-Sec
  2780. Salmonella sp. SJTUF14152 tRNA-Sec
  2781. Salmonella sp. SJTUF14154 tRNA-Sec
  2782. Salmonella sp. SJTUF14170 tRNA-Sec
  2783. Salmonella sp. SJTUF14178 tRNA-Sec
  2784. Salmonella sp. SJTUF14523 tRNA-Sec
  2785. Salmonella sp. SJTUF15034 tRNA-Sec
  2786. Salmonella sp. SSDFZ54 tRNA-Sec
  2787. Salmonella sp. SSDFZ69 tRNA-Sec
  2788. Salmonella sp. WGH-01 tRNA-Sec
  2789. Salmonella sp. XN2 tRNA-Sec
  2790. Salmonella sp. zj-f100 tRNA-Sec
  2791. Salmonella sp. zj-f50 tRNA-Sec
  2792. Salmonella sp. zj-f54 tRNA-Sec
  2793. Salmonella sp. zj-f60 tRNA-Sec
  2794. Salmonella sp. zj-f75 tRNA-Sec
  2795. Salmonella sp. zj-f78 tRNA-Sec
  2796. Salmonella sp. zj-f95 tRNA-Sec
  2797. Shigella boydii tRNA-Sec
  2798. Shigella dysenteriae 1012 tRNA-Sec
  2799. Shigella dysenteriae 1617 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2800. Shigella dysenteriae Sd197 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2801. Shigella dysenteriae tRNA-seC(tca)
  2802. Shigella flexneri 1a tRNA-Sec
  2803. Shigella flexneri 1b tRNA-Sec
  2804. Shigella flexneri 1c tRNA-Sec
  2805. Shigella flexneri 2002017 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2806. Shigella flexneri 2003036 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2807. Shigella flexneri 2a str. 2457T tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2808. Shigella flexneri 2a str. 301 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2809. Shigella flexneri 2a tRNA-seC(tca)
  2810. Shigella flexneri 2b tRNA-seC(tca)
  2811. Shigella flexneri 3a tRNA-Sec
  2812. Shigella flexneri 3b tRNA-Sec
  2813. Shigella flexneri 4c tRNA-Sec
  2814. Shigella flexneri 5a str. M90T tRNA-Sec
  2815. Shigella flexneri 5 str. 8401 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2816. Shigella flexneri G1663 tRNA-Sec
  2817. Shigella flexneri Shi06HN006 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2818. Shigella flexneri tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2819. Shigella flexneri Y tRNA-Sec
  2820. Shigella sonnei 53G tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2821. Shigella sonnei Ss046 tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2822. Shigella sonnei tRNA-seC(tca)
  2823. Shigella sp. CLA-AA-H239 tRNA-Sec
  2824. Shigella sp. (Escherichia coli 20-139 metagenome) tRNA-Sec
  2825. Shigella sp. FC1139 tRNA-Sec
  2826. Shigella sp. FC1172 tRNA-Sec
  2827. Shigella sp. FC1180 tRNA-Sec
  2828. Shigella sp. FC2045 tRNA-Sec
  2829. Shigella sp. FC2928 tRNA-Sec
  2830. Shigella sp. FC569 tRNA-Sec
  2831. Shigella sp. PAMC 28760 tRNA-Sec
  2832. Shigella sp. PIB tRNA-Sec
  2833. Streptococcus pneumoniae tRNA-seC(tca)
  2834. synthetic Escherichia coli C321.deltaA tRNA-SeC (TCA) (tRNA-SeC-TCA-1-1)
  2835. Trabulsiella guamensis ATCC 49490 tRNA-Sec
  2836. Trabulsiella odontotermitis tRNA-Sec
  2837. Vibrio parahaemolyticus tRNA-Sec
  2838. Xanthomonas citri pv. citri tRNA-Sec
  2839. Yokenella regensburgei ATCC 49455 tRNA-Sec
  2840. Yokenella regensburgei tRNA-seC(tca)
2D structure Publications