Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-2758-3p URS00002F9857_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-2758: Bmo-mir-2758 is a silkworm-specific miRNA that exhibits high sequence reads, comparable to abundant conserved miRNAs [PMC2838851]. Its expression in the posterior silk gland (PSG) increases gradually during larval development, reaching the highest levels on day 5 of the fifth instar [PMC4801057]. The bmo-mir-2758 inhibitor (anti-sense RNA) has been shown to restrain the posttranscriptional regulation function of bmo-mir-2758 [PMC4801057]. Bmo-mir-2758 significantly downregulates the expression of BmFMBP-1 at a posttranslational level by binding to its 3’-UTR complementary site [PMC4801057]. The primary sequence of bmo-mir-2758, pri-bmo-mir-2758, has been cloned into an expression vector to construct a bmo-mir-2758 expression plasmid [PMC4801057]. The relative expression levels of both bmo-mir-2758 and BmFMBP-1 in different silk gland regions at different developmental stages have been analyzed via semi-quantitative RT-PCR [PMC4801057]. In vitro experiments have shown that bmo-mir-2758 significantly inhibits the expression of BmFMBP-1 (P < .01) [PMC4801057]. The relative expression of bmo-mir-2758 is higher in PSG compared to mid-silk gland (MSG), suggesting that it mainly regulates BmFMBP1 in PSG [PMC4801057]. Co-transfection experiments have confirmed successful transfection and effective expression of bmo-miR 2758 in BmN cells using recombinant plasmids [PMC4801057]. Further studies are needed to understand the regulation of bmo-mir-2758 on the expression of BmFMBP-1 and other silk gland transcription factors in vivo [PMC4801057]. This study provides the first discussion on the expression of bmo-mir-2758 in fifth-instar silkworm larvae [PMC4801057].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUGCGUGUUCUACCAAGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications