Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1299 URS00002F74F1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1299: Hsa-mir-1299 is a microRNA that has been found to be down-regulated in the LCC2vsMCF-7 group, as well as in WP compared to CS [PMC7723334] [PMC7488025]. It has also been identified as part of the 9q21.11 deletion peak [PMC7859411]. Hsa-mir-1299 has been shown to bind to multiple mRNA targets [PMC9729703]. Studies have demonstrated that hsa-mir-1299 plays an inhibitory role in tumor cell proliferation, but its potential role in IS has not been addressed [PMC9729703]. Hsa-mir-1299 has also been found to be upregulated in exosomes in the culture medium of the UVA group, along with other microRNAs such as hsa-miR-4513 and hsa-miR-4422 [PMC7719707]. It has been shown that hsa_circ_0002476 and hsa_circ_0063526 can inhibit the expression of hsa-mir-1299 [PMC9659572]. Additionally, hsa-mir-1299 is predicted to be a potential target of circ_SMAD2 and circ-CSPP1 [PMC7890329] [PMC7260814]. Matsha et al. have demonstrated that hsa-mir-1299 is involved in the progression of type 2 diabetes mellitus [PMC8074411]. Furthermore, after statistical correction, hsa-miR-139-5p and hsa-miR200a3p remained significantly differentially expressed between OA patients and controls along with hsa_mir_1299 (p < 0.05) [PMCID: PMC6941326].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCUGGAAUUCUGUGUGAGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications