Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Threonine tRNA (tRNA-Thr), predicted by tRNAscan-SE analysis secondary structure diagram

Saccharomyces cerevisiae S288C Threonine tRNA (tRNA-Thr), predicted by tRNAscan-SE analysis URS00002EB333_559292

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (Rfam, SGD, ENA, GtRNAdb). Described in 27 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C Threonine tRNA (tRNA-Thr), predicted by tRNAscan-SE analysis sequence is a product of tRNA-Thr-TGT-1-1 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCCUCCUUAGCUUAGUGGUAGAGCGUUGCACUUGUAAUGCAAAGGUCGCUAGUUCAAUUCUGGCAGGUGGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 148 other species

    1. [Candida] glabrata tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    2. Kazachstania africana CBS 2517 tRNA-Thr (TGT) (tRNA-Thr-TGT-1 1 to 3)
    3. Kazachstania naganishii CBS 8797 tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    4. Kluyveromyces dobzhanskii CBS 2104 tRNA-Thr
    5. Kluyveromyces lactis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    6. Kluyveromyces marxianus DMKU3-1042 tRNA
    7. Kluyveromyces marxianus tRNA-Thr
    8. Kluyveromyces marxianus var. marxianus KCTC 17555 tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    9. Lachancea dasiensis tRNA
    10. Lachancea dasiensis tRNA-Thr (TGT) cove score=79.33
    11. Lachancea fermentati tRNA
    12. Lachancea kluyveri NRRL Y-12651 tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    13. Lachancea lanzarotensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    14. Lachancea meyersii CBS 8951 tRNA-Thr (TGT) cove score=79.33
    15. Lachancea mirantina tRNA
    16. Lachancea nothofagi CBS 11611 tRNA
    17. Lachancea quebecensis transfer RNA
    18. Lachancea sp. CBS 6924 tRNA-Thr (TGT) cove score=79.33
    19. Lachancea thermotolerans CBS 6340 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    20. Lachancea thermotolerans partial transfer RNA
    21. Metschnikowia aff. pulcherrima tRNA-Thr
    22. Saccharomyces boulardii (nom. inval.) tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    23. Saccharomyces cerevisiae AWRI796 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    24. Saccharomyces cerevisiae (baker's yeast) tRNA-OTHER
    25. Saccharomyces cerevisiae CBS 7960 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    26. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    27. Saccharomyces cerevisiae CLIB215 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    28. Saccharomyces cerevisiae CLIB324 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    29. Saccharomyces cerevisiae EC9-8 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    30. Saccharomyces cerevisiae FL100 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    31. Saccharomyces cerevisiae FostersB tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    32. Saccharomyces cerevisiae FostersO tRNA
    33. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    34. Saccharomyces cerevisiae P283 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    35. Saccharomyces cerevisiae P301 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    36. Saccharomyces cerevisiae PE-2 tRNA-Thr
    37. Saccharomyces cerevisiae PW5 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    38. Saccharomyces cerevisiae R008 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    39. Saccharomyces cerevisiae R103 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    40. Saccharomyces cerevisiae RM11-1a tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    41. Saccharomyces cerevisiae Sigma1278b tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    42. Saccharomyces cerevisiae T73 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    43. Saccharomyces cerevisiae T7 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    44. Saccharomyces cerevisiae UC5 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    45. Saccharomyces cerevisiae UFMG A-905 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    46. Saccharomyces cerevisiae VL3 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    47. Saccharomyces cerevisiae W303 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    48. Saccharomyces cerevisiae Y10 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    49. Saccharomyces cerevisiae YJM1078 tRNA-Thr
    50. Saccharomyces cerevisiae YJM1083 tRNA-Thr
    51. Saccharomyces cerevisiae YJM1129 tRNA-Thr
    52. Saccharomyces cerevisiae YJM1133 tRNA-Thr
    53. Saccharomyces cerevisiae YJM1199 tRNA-Thr
    54. Saccharomyces cerevisiae YJM1202 tRNA-Thr
    55. Saccharomyces cerevisiae YJM1208 tRNA-Thr
    56. Saccharomyces cerevisiae YJM1242 tRNA-Thr
    57. Saccharomyces cerevisiae YJM1244 tRNA-Thr
    58. Saccharomyces cerevisiae YJM1248 tRNA-Thr
    59. Saccharomyces cerevisiae YJM1250 tRNA-Thr
    60. Saccharomyces cerevisiae YJM1252 tRNA-Thr
    61. Saccharomyces cerevisiae YJM1273 tRNA-Thr
    62. Saccharomyces cerevisiae YJM1304 tRNA-Thr
    63. Saccharomyces cerevisiae YJM1307 tRNA-Thr
    64. Saccharomyces cerevisiae YJM1311 tRNA-Thr
    65. Saccharomyces cerevisiae YJM1326 tRNA-Thr
    66. Saccharomyces cerevisiae YJM1332 tRNA-Thr
    67. Saccharomyces cerevisiae YJM1336 tRNA-Thr
    68. Saccharomyces cerevisiae YJM1338 tRNA-Thr
    69. Saccharomyces cerevisiae YJM1341 tRNA-Thr
    70. Saccharomyces cerevisiae YJM1342 tRNA-Thr
    71. Saccharomyces cerevisiae YJM1355 tRNA-Thr
    72. Saccharomyces cerevisiae YJM1356 tRNA-Thr
    73. Saccharomyces cerevisiae YJM1381 tRNA-Thr
    74. Saccharomyces cerevisiae YJM1383 tRNA-Thr
    75. Saccharomyces cerevisiae YJM1385 tRNA-Thr
    76. Saccharomyces cerevisiae YJM1386 tRNA-Thr
    77. Saccharomyces cerevisiae YJM1387 tRNA-Thr
    78. Saccharomyces cerevisiae YJM1388 tRNA-Thr
    79. Saccharomyces cerevisiae YJM1389 tRNA-Thr
    80. Saccharomyces cerevisiae YJM1399 tRNA-Thr
    81. Saccharomyces cerevisiae YJM1400 tRNA-Thr
    82. Saccharomyces cerevisiae YJM1401 tRNA-Thr
    83. Saccharomyces cerevisiae YJM1402 tRNA-Thr
    84. Saccharomyces cerevisiae YJM1415 tRNA-Thr
    85. Saccharomyces cerevisiae YJM1417 tRNA-Thr
    86. Saccharomyces cerevisiae YJM1418 tRNA-Thr
    87. Saccharomyces cerevisiae YJM1419 tRNA-Thr
    88. Saccharomyces cerevisiae YJM1433 tRNA-Thr
    89. Saccharomyces cerevisiae YJM1434 tRNA-Thr
    90. Saccharomyces cerevisiae YJM1439 tRNA-Thr
    91. Saccharomyces cerevisiae YJM1444 tRNA-Thr
    92. Saccharomyces cerevisiae YJM1447 tRNA-Thr
    93. Saccharomyces cerevisiae YJM1450 tRNA-Thr
    94. Saccharomyces cerevisiae YJM1460 tRNA-Thr
    95. Saccharomyces cerevisiae YJM1463 tRNA-Thr
    96. Saccharomyces cerevisiae YJM1477 tRNA-Thr
    97. Saccharomyces cerevisiae YJM1478 tRNA-Thr
    98. Saccharomyces cerevisiae YJM1479 tRNA-Thr
    99. Saccharomyces cerevisiae YJM1526 tRNA-Thr
    100. Saccharomyces cerevisiae YJM1527 tRNA-Thr
    101. Saccharomyces cerevisiae YJM1549 tRNA-Thr
    102. Saccharomyces cerevisiae YJM1573 tRNA-Thr
    103. Saccharomyces cerevisiae YJM1592 tRNA-Thr
    104. Saccharomyces cerevisiae YJM1615 tRNA-Thr
    105. Saccharomyces cerevisiae YJM189 tRNA-Thr
    106. Saccharomyces cerevisiae YJM193 tRNA-Thr
    107. Saccharomyces cerevisiae YJM195 tRNA-Thr
    108. Saccharomyces cerevisiae YJM244 tRNA-Thr
    109. Saccharomyces cerevisiae YJM248 tRNA-Thr
    110. Saccharomyces cerevisiae YJM269 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    111. Saccharomyces cerevisiae YJM271 tRNA-Thr
    112. Saccharomyces cerevisiae YJM320 tRNA-Thr
    113. Saccharomyces cerevisiae YJM326 tRNA-Thr
    114. Saccharomyces cerevisiae YJM428 tRNA-Thr
    115. Saccharomyces cerevisiae YJM450 tRNA-Thr
    116. Saccharomyces cerevisiae YJM451 tRNA-Thr
    117. Saccharomyces cerevisiae YJM453 tRNA-Thr
    118. Saccharomyces cerevisiae YJM456 tRNA-Thr
    119. Saccharomyces cerevisiae YJM470 tRNA-Thr
    120. Saccharomyces cerevisiae YJM541 tRNA-Thr
    121. Saccharomyces cerevisiae YJM554 tRNA-Thr
    122. Saccharomyces cerevisiae YJM555 tRNA-Thr
    123. Saccharomyces cerevisiae YJM627 tRNA-Thr
    124. Saccharomyces cerevisiae YJM681 tRNA-Thr
    125. Saccharomyces cerevisiae YJM682 tRNA-Thr
    126. Saccharomyces cerevisiae YJM683 tRNA-Thr
    127. Saccharomyces cerevisiae YJM689 tRNA-Thr
    128. Saccharomyces cerevisiae YJM693 tRNA-Thr
    129. Saccharomyces cerevisiae YJM969 tRNA-Thr
    130. Saccharomyces cerevisiae YJM972 tRNA-Thr
    131. Saccharomyces cerevisiae YJM975 tRNA-Thr
    132. Saccharomyces cerevisiae YJM978 tRNA-Thr
    133. Saccharomyces cerevisiae YJM981 tRNA-Thr
    134. Saccharomyces cerevisiae YJM984 tRNA-Thr
    135. Saccharomyces cerevisiae YJM987 tRNA-Thr
    136. Saccharomyces cerevisiae YJM990 tRNA-Thr
    137. Saccharomyces cerevisiae YJM993 tRNA-Thr
    138. Saccharomyces cerevisiae YJM996 tRNA-Thr
    139. Saccharomyces cerevisiae YJSH1 tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    140. Saccharomyces eubayanus tRNA-Thr
    141. Saccharomyces pastorianus tRNA-Thr
    142. Tetrapisispora phaffii CBS 4417 tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    143. Torulaspora delbrueckii CBS 1146 tRNA
    144. Torulaspora delbrueckii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    145. Torulaspora globosa tRNA-Thr
    146. Torulaspora sp. CBS 2947 tRNA-Thr
    147. Vanderwaltozyma polyspora DSM 70294 tRNA-Thr (TGT) (tRNA-Thr-TGT-1 1 to 4)
    148. Zygotorulaspora mrakii tRNA-Thr
    2D structure New