Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila mojavensis dmo-miR-34 URS00002DEA5C_7230

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAGUGUGGUUAGCUGGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-34-5p
  2. Bombyx mori (domestic silkworm) bmo-miR-34-5p
  3. Drosophila ananassae dan-miR-34
  4. Drosophila erecta der-miR-34
  5. Drosophila grimshawi dgr-miR-34
  6. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-1562
  7. Drosophila persimilis dpe-miR-34
  8. Drosophila pseudoobscura dps-miR-34
  9. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0294383_df_nrg
  10. Drosophila sechellia dse-miR-34
  11. Drosophila simulans dsi-miR-34
  12. Drosophila willistoni dwi-miR-34
  13. Drosophila yakuba dya-miR-34
  14. Heliconius melpomene hme-miR-34
  15. Heligmosomoides polygyrus hpo-miR-34-5p
  16. Nasonia vitripennis nvi-miR-34
  17. Panagrellus redivivus prd-miR-34-5p
  18. Patiria miniata (sea bat) pmi-miR-34-5p
  19. Ptychodera flava Pfl-Mir-34_5p (mature (guide))
  20. Saccoglossus kowalevskii sko-miR-34-5p
  21. Strongyloides ratti str-miR-34a-5p
  22. Triops cancriformis tcf-miR-34