Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-23c URS00002DD349_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-23c: As Figure 3B shows, among all the upstream miRNAs, hsa-miR-22-3p was negatively correlated with PCGF1, and hsa-mir-23c was positively correlated with PCGF1 in LIHC [PMC9469147]. In addition, these predicted miRNAs were previously reported that hsa-let-7b-5p, hsa-let-7c-5p and hsa-let-7i-5p were up-regulated and hsa-mir-23c and hsa-miR-182-5p were down-regulated in NOA [PMC7041731]. The correlation between lncRNAs and hsa-miR-101-3p, hsa-miR-125b-5p and hsa-mir-23c was detected by the ENCORI database, and the results showed that 14 lncRNAs were significantly associated with hsa-miR-101-3p and GLS, 9 lncRNAs were significantly associated with hsa-miR-125b-5p and CDKN2A, 10 lncRNAs were significantly associated with hsa-miR-125b-5p and GLS, 4 lncRNAs were significantly associated with hsa-miR-125b-5p and PDHA1, and 12 lncRNAs were significantly associated with hsa-mir-23c and GLS [PMC9986498]. A direct comparison of miRNA levels between the two neoplasias (by miRanalyzer tool Differential expression analysis) showed 13 upregulated miRNAs (hsa-miR-1292-5p, hsa-140-5p, hsa-miR-184, hsa-miR-1908, hsa-miR-23b-5p, has-miR-3198, hsa-miR-323b-3p, hsa-miR-331-3p, hsa-miR-409-5p, hsa-miR-4683, hsa-miR-4707-3p, hsa-miR-505-5p, hsa-miR-5706), and 5 down-regulated miRNAs (hsa-miR-106a-5p, hsa-miR-200b-3p, hsa-miR-216b, hsa-mir-23c, hsa-miR-29b-3p) in MPM compared to AD [PMC4464514]. As shown in Figure 2A, the expression levels of hsa-miR-323b-3p, hsa-miR-323b-3p, hsa-miR-371a-5p, hsa-miR-708-3p, hsa-miR-6852-5p, hsa-miR-767-5p, hsa-miR-382-5p, and hsa-miR-514a-3p were significantly upregulated in SW620-Smad4 cells, whereas, as shown in Figure 2B, hsa-miR-1289, hsa-miR-1537-5p, hsa-mir-23c, hsa-miR-3199, hsa-miR-3619-5p, hsa-miR-3657, hsa-miR-548u, hsa-miR-5699-5p, and hsa-miR-874-5p were downregulated [PMC6235008].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCACAUUGCCAGUGAUUACCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla gorilla ggo-miR-23c (MIR23C)
  2. Gorilla gorilla ggo-miR-23c
  3. Pan troglodytes ptr-miR-23c
Publications