Homo sapiens (human) long intergenic non-protein coding RNA 308 (LINC00308)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 308 (LINC00308) URS00002DC28C_9606

727 nucleotides
8 databases (Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, LNCipedia, NONCODE, RefSeq)
Found in 0 other species
26 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00308: LINC00308 is a long non-coding RNA (lncRNA) that has been implicated in the progression and prognosis of prostate cancer [PMC6172814]. It is included in the ceRNA network along with LINC00355 and OSTN-AS1, suggesting their important roles in prostate cancer [PMC6172814]. The genes related to LINC00308 were predicted through the construction of an lncRNA-miRNA-mRNA network [PMC6172814]. However, the specific function of LINC00308 has not been examined [PMC6172814]. In prostate cancer, LINC00308 has been found to correlate negatively with overall survival, while LINC00355 and OSTN-AS1 are positively associated with overall survival [PMC6172814]. These three lncRNAs (LINC00308, OSTN-AS1, and LINC00355) are related to clinical prognosis in prostate cancer patients [PMC6172814]. LINC00308 has also been identified as one of the lncRNAs associated with lapatinib resistance in breast cancer along with MIR181A1 and LOC647107 [PMC5126759]. In addition, it has been found to be overexpressed in prostate cancer cell lines compared to normal myofibroblast stromal cell lines as well as in cancer tissues compared to non-cancerous tissues [PMC6042310] [PMC6042310]. Overall, LINC00308 is a lncRNA that shows potential as a prognostic biomarker for prostate cancer. However, further research is needed to fully understand its function and its role in disease progression.

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

(human) hsa-miR-582-5p

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CAGAUAAGACUCUGUCUACCCUGGGCAGCUUUCCUGAUCCAUGGCAGUCUGGCUUACAAGCAAUACUAGGCUUCUAUUGUCUCUUUCUGUAUAUUUAUAAGAAACAUGGCCAGGCAAGAUGGCUUAUGUCUUUAAUCUCAGCUGUUUGGGAAGCCAAGUGGAAAGAUUGCUUGAGGCCAGGAGUUCAAGACCAACCUGGAUAAUACAGCCCAGUCCCAAAAAAGCACCUGAAGCUUGUUUUAGUUUUCAUUCUUCUUAUGAGAGAAAUUGGGCCUGAUGCUGAAGGAGAACUCUUCUGUCCACUGCAAGUCCACUUACAUGAGCAGCUAAAUAAAUGAAUGGGAUUCUGAAGGACUGUAUGUGGAGAGCAAGGUUAACCAUUUGUGCUUGCUGCAUGAGUGAAUAAGCAACGAUGAGUGUUAGGCUGUUUAUUCAGAUACCCUCACGCCACUGCAGAAGCGAGUAGAGGAAGAAUACAAGGAAAAAAGUGUCUCCCAGCCUGUGGAAAGAGGAUGGCUAUUUCAUCCACUAAAGGUGUACACUUUAAGUGAAUUGGUAUGUCUACAUCAUCCCAGGAGGAGUGAAUGUCUGUGUGUGUGUACCUGAGAUAAGAUGAUGUCUUGUCCAAUGCUGGUUUCCACCUUGUGCCCUGAGCUGUUGGGAGAGGCUCCUGCGACCUGUGACCCUGAAGCAGAAUAAGUGGACUGAAUAAAGGAAUGAUGCGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications