Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae R008 tRNA-Phe secondary structure diagram

Saccharomyces cerevisiae R008 tRNA-Phe URS00002D9D76_1182966

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAAAAACUUCGGUCAAGUCAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Fusarium falciforme tRNA-Phe
  2. Saccharomyces cerevisiae AWRI796 tRNA
  3. Saccharomyces cerevisiae tF(UUY)B - systematic name
  4. Saccharomyces cerevisiae EC1118 tRNA-Phe
  5. Saccharomyces cerevisiae FostersB tRNA
  6. Saccharomyces cerevisiae FostersO tRNA
  7. Saccharomyces cerevisiae Lalvin QA23 tRNA
  8. Saccharomyces cerevisiae P301 tRNA-Phe
  9. Saccharomyces cerevisiae R103 tRNA-Phe
  10. Saccharomyces cerevisiae RM11-1a tRNA-Phe
  11. Saccharomyces cerevisiae S288C tRNA-Phe
  12. Saccharomyces cerevisiae Vin13 tRNA
  13. Saccharomyces cerevisiae VL3 tRNA
2D structure