Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pongo abelii tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1) secondary structure diagram

Pongo abelii tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1) URS00002D7BB5_9601

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCCUCCUAAGCCAGGGAUUGUGGGUUCGAGUCCCACCUGGGGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Ailuropoda melanoleuca tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  2. Balaenoptera acutorostrata scammoni tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  3. Bos taurus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  4. Callithrix jacchus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  5. Camelus ferus (Wild Bactrian camel) tRNA
  6. Canis lupus familiaris tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  7. Carlito syrichta tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  8. Cavia porcellus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  9. Ceratotherium simum simum tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  10. Chlorocebus sabaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1, tRNA-Arg-CCT-4-2)
  11. Choloepus hoffmanni tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  12. Cricetulus griseus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  13. Dasypus novemcinctus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  14. Dipodomys ordii tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  15. Echinops telfairi tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  16. Eptesicus nilssonii tRNA-Arg
  17. Equus caballus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  18. Erinaceus europaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  19. Felis catus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  20. Fukomys damarensis tRNA
  21. Gorilla gorilla gorilla tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  22. Heterocephalus glaber tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  23. Homo sapiens tRNA-Arg (anticodon CCT) 1-1 (TRR-CCT1-1)
  24. Ictidomys tridecemlineatus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  25. Loxodonta africana tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  26. Macaca mulatta tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  27. Marmota monax tRNA.Arg
  28. Mesocricetus auratus tRNA
  29. Microcebus murinus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  30. Monodelphis domestica tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  31. Mus caroli tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  32. Mus musculus castaneus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  33. Mus musculus domesticus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  34. Mus musculus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  35. Mus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-2-1)
  36. Mus pahari tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  37. Mus spretus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  38. Mustela putorius furo tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  39. Myotis brandtii tRNA
  40. Myotis davidii tRNA
  41. Myotis lucifugus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  42. Neotoma lepida tRNA
  43. Nomascus leucogenys tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  44. Ochotona princeps tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  45. Oryctolagus cuniculus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  46. Otolemur garnettii tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  47. Ovis aries tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
  48. Pan troglodytes tRNA-Arg (CCT) (tRNA-Arg-CCT-1 1 to 3)
  49. Papio anubis tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  50. Petromyzon marinus tRNA-Arg (CCT) (tRNA-Arg-CCT-3 1 to 11)
  51. Procavia capensis tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  52. Rattus norvegicus tRNA-Arg (CCT) (tRNA-Arg-CCT-2 1 to 3)
  53. Saimiri boliviensis boliviensis tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  54. Sarcophilus harrisii tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  55. Sorex araneus tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  56. Sus scrofa tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-1-2)
  57. Trichechus manatus latirostris tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  58. Tupaia chinensis (Chinese tree shrew) tRNA
  59. Tursiops truncatus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  60. Vicugna pacos tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-2-2)
2D structure Publications